Search for Variation information by Variation ID:
Detailed information for vg0311298528:
| Variant ID: vg0311298528 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 11298528 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
ATCGTCGTAAAAAGCTGCAAGGCTTTCGACCACGTGTCCAACCTGCAGGAGACCTTCGACAACTTGCCCGCAGCAGGTATGAAACTAAATCCTGAGAAGT[G/T]
TGTTTTTGGCGTTCACGCAGGCAAGTTGTTGGGTTTCCTTGTTTCTGAAAGAGGCATCGAGGCGAATCCCGAGAAAATCGATGCCATTCAGCAAATGAAG
Reverse complement sequence
CTTCATTTGCTGAATGGCATCGATTTTCTCGGGATTCGCCTCGATGCCTCTTTCAGAAACAAGGAAACCCAACAACTTGCCTGCGTGAACGCCAAAAACA[C/A]
ACTTCTCAGGATTTAGTTTCATACCTGCTGCGGGCAAGTTGTCGAAGGTCTCCTGCAGGTTGGACACGTGGTCGAAAGCCTTGCAGCTTTTTACGACGAT
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.80% | 21.50% | 1.25% | 1.46% | NA |
| All Indica | 2759 | 98.80% | 0.70% | 0.43% | 0.07% | NA |
| All Japonica | 1512 | 29.90% | 63.00% | 2.84% | 4.23% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 0.40% | 0.66% | 0.22% | NA |
| Indica Intermediate | 786 | 98.00% | 1.40% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 73.00% | 9.10% | 6.94% | 10.91% | NA |
| Japonica Intermediate | 241 | 29.90% | 63.10% | 3.32% | 3.73% | NA |
| VI/Aromatic | 96 | 80.20% | 17.70% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 67.80% | 26.70% | 3.33% | 2.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0311298528 | G -> T | LOC_Os03g20050.1 | missense_variant ; p.Cys359Phe; MODERATE | nonsynonymous_codon ; C359F | Average:28.302; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | possibly damaging  |
1.752 |
DELETERIOUS | 0.00 |
| vg0311298528 | G -> DEL | LOC_Os03g20050.1 | N | frameshift_variant | Average:28.302; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0311298528 | NA | 3.15E-11 | mr1241 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311298528 | NA | 1.09E-12 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311298528 | NA | 7.03E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311298528 | NA | 4.15E-58 | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311298528 | NA | 9.20E-07 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311298528 | NA | 1.25E-07 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311298528 | NA | 3.46E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0311298528 | 3.40E-06 | 1.91E-55 | mr1991_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |