\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310499546:

Variant ID: vg0310499546 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10499546
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


AAGATCAAACTAAAATAAGAAGAGCACATTTATTCAAGTCTATTTGTGAATCTCCATCCATAGTTTGCAAAGAGTTGTATGACCGTTGTCTTAAGCCTAC[C/A]
ACATGCAACCTTCATAAGCACTCTATCATCTTCACACATTTGCAGCTGAATCGCCTCCGTGTCTAATCCCACGGTCTGACGGTCATATGCTTATGCCCGA

Reverse complement sequence

TCGGGCATAAGCATATGACCGTCAGACCGTGGGATTAGACACGGAGGCGATTCAGCTGCAAATGTGTGAAGATGATAGAGTGCTTATGAAGGTTGCATGT[G/T]
GTAGGCTTAAGACAACGGTCATACAACTCTTTGCAAACTATGGATGGAGATTCACAAATAGACTTGAATAAATGTGCTCTTCTTATTTTAGTTTGATCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 8.20% 0.02% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 76.30% 23.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 39.50% 60.50% 0.00% 0.00% NA
Japonica Intermediate  241 79.70% 19.90% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310499546 C -> A LOC_Os03g18740.1 upstream_gene_variant ; 2469.0bp to feature; MODIFIER silent_mutation Average:55.752; most accessible tissue: Callus, score: 76.776 N N N N
vg0310499546 C -> A LOC_Os03g18729-LOC_Os03g18740 intergenic_region ; MODIFIER silent_mutation Average:55.752; most accessible tissue: Callus, score: 76.776 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310499546 NA 6.84E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310499546 NA 3.58E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310499546 2.43E-07 NA mr1925 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310499546 1.09E-06 2.52E-08 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310499546 NA 4.19E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310499546 NA 7.13E-09 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310499546 NA 7.04E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251