\
| Variant ID: vg0310272191 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 10272191 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATATTTATTATATTTATTTTTTAAGTTGCTGGATTGTTTCCAATAAAAAATGACTCTTTAAGGCCCTAGCATCAATTAACTTCAAATACGACTCTCTTTA[G/A]
AATTTGGGATTTCATCATGTACAGCAACATAACTCAATTTATAGTTGCCTATCAACGTAACTAACCTTAAAAGCTGCCTGCACCTGCCAGCGGTAAGATT
AATCTTACCGCTGGCAGGTGCAGGCAGCTTTTAAGGTTAGTTACGTTGATAGGCAACTATAAATTGAGTTATGTTGCTGTACATGATGAAATCCCAAATT[C/T]
TAAAGAGAGTCGTATTTGAAGTTAATTGATGCTAGGGCCTTAAAGAGTCATTTTTTATTGGAAACAATCCAGCAACTTAAAAAATAAATATAATAAATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.80% | 1.90% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 96.30% | 3.30% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.90% | 15.30% | 0.84% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0310272191 | G -> A | LOC_Os03g18320.1 | upstream_gene_variant ; 417.0bp to feature; MODIFIER | silent_mutation | Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0310272191 | G -> A | LOC_Os03g18330.1 | upstream_gene_variant ; 2685.0bp to feature; MODIFIER | silent_mutation | Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0310272191 | G -> A | LOC_Os03g18340.1 | upstream_gene_variant ; 4851.0bp to feature; MODIFIER | silent_mutation | Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0310272191 | G -> A | LOC_Os03g18310.1 | downstream_gene_variant ; 1018.0bp to feature; MODIFIER | silent_mutation | Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0310272191 | G -> A | LOC_Os03g18310.3 | downstream_gene_variant ; 2803.0bp to feature; MODIFIER | silent_mutation | Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0310272191 | G -> A | LOC_Os03g18310.2 | downstream_gene_variant ; 1018.0bp to feature; MODIFIER | silent_mutation | Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| vg0310272191 | G -> A | LOC_Os03g18320-LOC_Os03g18330 | intergenic_region ; MODIFIER | silent_mutation | Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0310272191 | 1.77E-06 | NA | Plant_height | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0310272191 | NA | 1.52E-07 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 2.93E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 3.55E-07 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 2.61E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 1.05E-07 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 1.43E-06 | mr1219_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 7.38E-07 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 1.74E-06 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 1.64E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 2.77E-07 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 3.93E-10 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 1.84E-06 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0310272191 | NA | 1.20E-07 | mr1923_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |