\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0310272191:

Variant ID: vg0310272191 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 10272191
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATTTATTATATTTATTTTTTAAGTTGCTGGATTGTTTCCAATAAAAAATGACTCTTTAAGGCCCTAGCATCAATTAACTTCAAATACGACTCTCTTTA[G/A]
AATTTGGGATTTCATCATGTACAGCAACATAACTCAATTTATAGTTGCCTATCAACGTAACTAACCTTAAAAGCTGCCTGCACCTGCCAGCGGTAAGATT

Reverse complement sequence

AATCTTACCGCTGGCAGGTGCAGGCAGCTTTTAAGGTTAGTTACGTTGATAGGCAACTATAAATTGAGTTATGTTGCTGTACATGATGAAATCCCAAATT[C/T]
TAAAGAGAGTCGTATTTGAAGTTAATTGATGCTAGGGCCTTAAAGAGTCATTTTTTATTGGAAACAATCCAGCAACTTAAAAAATAAATATAATAAATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.80% 1.90% 0.21% 0.00% NA
All Indica  2759 96.30% 3.30% 0.36% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 83.90% 15.30% 0.84% 0.00% NA
Indica II  465 99.10% 0.00% 0.86% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0310272191 G -> A LOC_Os03g18320.1 upstream_gene_variant ; 417.0bp to feature; MODIFIER silent_mutation Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0310272191 G -> A LOC_Os03g18330.1 upstream_gene_variant ; 2685.0bp to feature; MODIFIER silent_mutation Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0310272191 G -> A LOC_Os03g18340.1 upstream_gene_variant ; 4851.0bp to feature; MODIFIER silent_mutation Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0310272191 G -> A LOC_Os03g18310.1 downstream_gene_variant ; 1018.0bp to feature; MODIFIER silent_mutation Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0310272191 G -> A LOC_Os03g18310.3 downstream_gene_variant ; 2803.0bp to feature; MODIFIER silent_mutation Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0310272191 G -> A LOC_Os03g18310.2 downstream_gene_variant ; 1018.0bp to feature; MODIFIER silent_mutation Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0310272191 G -> A LOC_Os03g18320-LOC_Os03g18330 intergenic_region ; MODIFIER silent_mutation Average:43.534; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0310272191 1.77E-06 NA Plant_height Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0310272191 NA 1.52E-07 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 2.93E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 3.55E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 2.61E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 1.05E-07 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 1.43E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 7.38E-07 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 1.74E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 1.64E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 2.77E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 3.93E-10 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 1.84E-06 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0310272191 NA 1.20E-07 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251