\
| Variant ID: vg0309056044 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 9056044 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTTCCCATTTTGTTCCCTAGGATGTCCCGGAGATCGTCCGCCCGTCGCCGTCGTCCTCCCGTCGCTCGTCGTCGTCGTTCGCCGTCGTCTCCACTCGCGC[T/C]
GGCCAACCTCGGTGAGAAACTCCCTCTCCTCCCTCTTTCCCTCTCTCTCGTGTGCGCCGCTGTTGTCACGCCCAGAAATTCCCGAATAGAATTCCAAGCA
TGCTTGGAATTCTATTCGGGAATTTCTGGGCGTGACAACAGCGGCGCACACGAGAGAGAGGGAAAGAGGGAGGAGAGGGAGTTTCTCACCGAGGTTGGCC[A/G]
GCGCGAGTGGAGACGACGGCGAACGACGACGACGAGCGACGGGAGGACGACGGCGACGGGCGGACGATCTCCGGGACATCCTAGGGAACAAAATGGGAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.90% | 4.70% | 15.83% | 29.60% | NA |
| All Indica | 2759 | 29.80% | 2.50% | 22.36% | 45.34% | NA |
| All Japonica | 1512 | 89.00% | 9.70% | 0.53% | 0.79% | NA |
| Aus | 269 | 22.70% | 0.40% | 36.43% | 40.52% | NA |
| Indica I | 595 | 67.10% | 0.50% | 6.55% | 25.88% | NA |
| Indica II | 465 | 11.00% | 1.30% | 14.62% | 73.12% | NA |
| Indica III | 913 | 18.70% | 5.30% | 37.79% | 38.23% | NA |
| Indica Intermediate | 786 | 25.40% | 1.70% | 20.99% | 51.91% | NA |
| Temperate Japonica | 767 | 84.90% | 14.10% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 92.50% | 6.00% | 1.19% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.00% | 3.30% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 80.20% | 0.00% | 14.58% | 5.21% | NA |
| Intermediate | 90 | 57.80% | 5.60% | 12.22% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0309056044 | T -> C | LOC_Os03g16410.1 | upstream_gene_variant ; 3722.0bp to feature; MODIFIER | silent_mutation | Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0309056044 | T -> C | LOC_Os03g16400.1 | downstream_gene_variant ; 4586.0bp to feature; MODIFIER | silent_mutation | Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0309056044 | T -> C | LOC_Os03g16410-LOC_Os03g16420 | intergenic_region ; MODIFIER | silent_mutation | Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0309056044 | T -> DEL | N | N | silent_mutation | Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0309056044 | NA | 3.97E-07 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309056044 | NA | 2.39E-09 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309056044 | NA | 5.22E-08 | mr1875 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309056044 | NA | 3.20E-06 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309056044 | NA | 2.70E-09 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309056044 | NA | 4.21E-08 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0309056044 | NA | 1.04E-10 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |