\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0309056044:

Variant ID: vg0309056044 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 9056044
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCCCATTTTGTTCCCTAGGATGTCCCGGAGATCGTCCGCCCGTCGCCGTCGTCCTCCCGTCGCTCGTCGTCGTCGTTCGCCGTCGTCTCCACTCGCGC[T/C]
GGCCAACCTCGGTGAGAAACTCCCTCTCCTCCCTCTTTCCCTCTCTCTCGTGTGCGCCGCTGTTGTCACGCCCAGAAATTCCCGAATAGAATTCCAAGCA

Reverse complement sequence

TGCTTGGAATTCTATTCGGGAATTTCTGGGCGTGACAACAGCGGCGCACACGAGAGAGAGGGAAAGAGGGAGGAGAGGGAGTTTCTCACCGAGGTTGGCC[A/G]
GCGCGAGTGGAGACGACGGCGAACGACGACGACGAGCGACGGGAGGACGACGGCGACGGGCGGACGATCTCCGGGACATCCTAGGGAACAAAATGGGAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 4.70% 15.83% 29.60% NA
All Indica  2759 29.80% 2.50% 22.36% 45.34% NA
All Japonica  1512 89.00% 9.70% 0.53% 0.79% NA
Aus  269 22.70% 0.40% 36.43% 40.52% NA
Indica I  595 67.10% 0.50% 6.55% 25.88% NA
Indica II  465 11.00% 1.30% 14.62% 73.12% NA
Indica III  913 18.70% 5.30% 37.79% 38.23% NA
Indica Intermediate  786 25.40% 1.70% 20.99% 51.91% NA
Temperate Japonica  767 84.90% 14.10% 0.00% 1.04% NA
Tropical Japonica  504 92.50% 6.00% 1.19% 0.40% NA
Japonica Intermediate  241 95.00% 3.30% 0.83% 0.83% NA
VI/Aromatic  96 80.20% 0.00% 14.58% 5.21% NA
Intermediate  90 57.80% 5.60% 12.22% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0309056044 T -> C LOC_Os03g16410.1 upstream_gene_variant ; 3722.0bp to feature; MODIFIER silent_mutation Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0309056044 T -> C LOC_Os03g16400.1 downstream_gene_variant ; 4586.0bp to feature; MODIFIER silent_mutation Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0309056044 T -> C LOC_Os03g16410-LOC_Os03g16420 intergenic_region ; MODIFIER silent_mutation Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0309056044 T -> DEL N N silent_mutation Average:54.142; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0309056044 NA 3.97E-07 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044 NA 2.39E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044 NA 5.22E-08 mr1875 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044 NA 3.20E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044 NA 2.70E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044 NA 4.21E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0309056044 NA 1.04E-10 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251