Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0308368499:

Variant ID: vg0308368499 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 8368499
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTAAGTGAGCCCGGCCTGGGAGAGGCGGGCCGTTACAAAGTGGTATCAGGTCGTTACAAAGTGGTATCAGAAAAGACTTGTGTTGGTCTGGTCTATGA[T/C]
CTACGAAAGCTACCAGATGTAAGTGAGCTCGGCCTGGGAGAGGCGGACCGTTACAAAGTGGTATCAGGTCGTTACAAAGTGGTATCAGAAAAGACTTGTG

Reverse complement sequence

CACAAGTCTTTTCTGATACCACTTTGTAACGACCTGATACCACTTTGTAACGGTCCGCCTCTCCCAGGCCGAGCTCACTTACATCTGGTAGCTTTCGTAG[A/G]
TCATAGACCAGACCAACACAAGTCTTTTCTGATACCACTTTGTAACGACCTGATACCACTTTGTAACGGCCCGCCTCTCCCAGGCCGGGCTCACTTACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.40%	7.40%	1.18%	24.02%	NA
All Indica	2759	97.80%	0.30%	0.11%	1.85%	NA
All Japonica	1512	5.40%	21.80%	2.98%	69.84%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.50%	0.40%	0.00%	1.08%	NA
Indica III	913	97.70%	0.00%	0.22%	2.08%	NA
Indica Intermediate	786	95.80%	0.60%	0.13%	3.44%	NA
Temperate Japonica	767	2.30%	40.90%	0.78%	55.93%	NA
Tropical Japonica	504	10.90%	0.40%	4.96%	83.73%	NA
Japonica Intermediate	241	3.30%	5.80%	5.81%	85.06%	NA
VI/Aromatic	96	92.70%	0.00%	1.04%	6.25%	NA
Intermediate	90	56.70%	12.20%	7.78%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0308368499	T -> C	LOC_Os03g15290.1	upstream_gene_variant ; 848.0bp to feature; MODIFIER	silent_mutation	Average:72.898; most accessible tissue: Minghui63 young leaf, score: 83.419	N	N	N	N
vg0308368499	T -> C	LOC_Os03g15300.1	downstream_gene_variant ; 2898.0bp to feature; MODIFIER	silent_mutation	Average:72.898; most accessible tissue: Minghui63 young leaf, score: 83.419	N	N	N	N
vg0308368499	T -> C	LOC_Os03g15280-LOC_Os03g15290	intergenic_region ; MODIFIER	silent_mutation	Average:72.898; most accessible tissue: Minghui63 young leaf, score: 83.419	N	N	N	N
vg0308368499	T -> DEL	N	N	silent_mutation	Average:72.898; most accessible tissue: Minghui63 young leaf, score: 83.419	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0308368499	NA	3.95E-08	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308368499	NA	7.58E-06	mr1161	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308368499	NA	2.18E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308368499	NA	9.30E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308368499	NA	1.86E-14	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308368499	1.16E-06	NA	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308368499	6.28E-07	6.27E-07	mr1779	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308368499	NA	1.19E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308368499	NA	3.61E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308368499	NA	1.03E-09	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308368499	NA	7.23E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251