\
| Variant ID: vg0308368499 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 8368499 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 245. )
ATGTAAGTGAGCCCGGCCTGGGAGAGGCGGGCCGTTACAAAGTGGTATCAGGTCGTTACAAAGTGGTATCAGAAAAGACTTGTGTTGGTCTGGTCTATGA[T/C]
CTACGAAAGCTACCAGATGTAAGTGAGCTCGGCCTGGGAGAGGCGGACCGTTACAAAGTGGTATCAGGTCGTTACAAAGTGGTATCAGAAAAGACTTGTG
CACAAGTCTTTTCTGATACCACTTTGTAACGACCTGATACCACTTTGTAACGGTCCGCCTCTCCCAGGCCGAGCTCACTTACATCTGGTAGCTTTCGTAG[A/G]
TCATAGACCAGACCAACACAAGTCTTTTCTGATACCACTTTGTAACGACCTGATACCACTTTGTAACGGCCCGCCTCTCCCAGGCCGGGCTCACTTACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 7.40% | 1.18% | 24.02% | NA |
| All Indica | 2759 | 97.80% | 0.30% | 0.11% | 1.85% | NA |
| All Japonica | 1512 | 5.40% | 21.80% | 2.98% | 69.84% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 0.40% | 0.00% | 1.08% | NA |
| Indica III | 913 | 97.70% | 0.00% | 0.22% | 2.08% | NA |
| Indica Intermediate | 786 | 95.80% | 0.60% | 0.13% | 3.44% | NA |
| Temperate Japonica | 767 | 2.30% | 40.90% | 0.78% | 55.93% | NA |
| Tropical Japonica | 504 | 10.90% | 0.40% | 4.96% | 83.73% | NA |
| Japonica Intermediate | 241 | 3.30% | 5.80% | 5.81% | 85.06% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 1.04% | 6.25% | NA |
| Intermediate | 90 | 56.70% | 12.20% | 7.78% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0308368499 | T -> C | LOC_Os03g15290.1 | upstream_gene_variant ; 848.0bp to feature; MODIFIER | silent_mutation | Average:72.898; most accessible tissue: Minghui63 young leaf, score: 83.419 | N | N | N | N |
| vg0308368499 | T -> C | LOC_Os03g15300.1 | downstream_gene_variant ; 2898.0bp to feature; MODIFIER | silent_mutation | Average:72.898; most accessible tissue: Minghui63 young leaf, score: 83.419 | N | N | N | N |
| vg0308368499 | T -> C | LOC_Os03g15280-LOC_Os03g15290 | intergenic_region ; MODIFIER | silent_mutation | Average:72.898; most accessible tissue: Minghui63 young leaf, score: 83.419 | N | N | N | N |
| vg0308368499 | T -> DEL | N | N | silent_mutation | Average:72.898; most accessible tissue: Minghui63 young leaf, score: 83.419 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0308368499 | NA | 3.95E-08 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308368499 | NA | 7.58E-06 | mr1161 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308368499 | NA | 2.18E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308368499 | NA | 9.30E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308368499 | NA | 1.86E-14 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308368499 | 1.16E-06 | NA | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308368499 | 6.28E-07 | 6.27E-07 | mr1779 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308368499 | NA | 1.19E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308368499 | NA | 3.61E-08 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308368499 | NA | 1.03E-09 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0308368499 | NA | 7.23E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |