Variant ID: vg0308314268 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 8314268 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, T: 0.01, others allele: 0.00, population size: 94. )
TACGCAAACAAACAAAAACCTAAACAAAAGACCAAGAAAAAGACCCTATTTAGACTGAATAATAGTGCCATTAAATAGATCTCAATTTTACGGAATTACT[A/G]
GAAGTTGAACGGAGTCAATCGGAAGAGCGGTTGGGAAGATATGAATTTTGGAAGTTTAATTGGAATTTCTGGAAGACGAGAAATGGTTTATGGAATTTAT
ATAAATTCCATAAACCATTTCTCGTCTTCCAGAAATTCCAATTAAACTTCCAAAATTCATATCTTCCCAACCGCTCTTCCGATTGACTCCGTTCAACTTC[T/C]
AGTAATTCCGTAAAATTGAGATCTATTTAATGGCACTATTATTCAGTCTAAATAGGGTCTTTTTCTTGGTCTTTTGTTTAGGTTTTTGTTTGTTTGCGTA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 91.30% | 8.10% | 0.51% | 0.00% | NA |
All Indica | 2759 | 97.40% | 1.80% | 0.83% | 0.00% | NA |
All Japonica | 1512 | 79.20% | 20.80% | 0.07% | 0.00% | NA |
Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.20% | 0.80% | 1.01% | 0.00% | NA |
Indica II | 465 | 97.80% | 1.50% | 0.65% | 0.00% | NA |
Indica III | 913 | 96.50% | 2.60% | 0.88% | 0.00% | NA |
Indica Intermediate | 786 | 97.50% | 1.80% | 0.76% | 0.00% | NA |
Temperate Japonica | 767 | 61.00% | 38.90% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0308314268 | A -> G | LOC_Os03g15190.1 | upstream_gene_variant ; 2711.0bp to feature; MODIFIER | silent_mutation | Average:10.153; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
vg0308314268 | A -> G | LOC_Os03g15190-LOC_Os03g15200 | intergenic_region ; MODIFIER | silent_mutation | Average:10.153; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0308314268 | NA | 9.39E-07 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0308314268 | NA | 8.09E-07 | mr1171 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0308314268 | NA | 5.19E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0308314268 | 6.30E-07 | NA | mr1585 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0308314268 | NA | 1.16E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0308314268 | NA | 1.62E-14 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0308314268 | NA | 1.23E-06 | mr1712 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0308314268 | 1.52E-06 | 1.52E-06 | mr1779 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0308314268 | NA | 1.17E-08 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0308314268 | NA | 2.40E-08 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0308314268 | NA | 5.84E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |