Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0308212271:

Variant ID: vg0308212271 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 8212271
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGCTCATGATTAATTAAGTATTAACTATTTTAAATTTCAAAAATGAATTAATATGATTTTTTAAAACAATTTTCCTATTTAATTTATTTTAAAAAAAC[G/A]
CACCGTTTAGTAATTTGAAAAGCGTGCGCGCGGAAAACAAGACTCAATCTCCCCTATCACCGAACAGAGCCTAAGTTTATCCACTTGGACAGTGGGGGTG

Reverse complement sequence

CACCCCCACTGTCCAAGTGGATAAACTTAGGCTCTGTTCGGTGATAGGGGAGATTGAGTCTTGTTTTCCGCGCGCACGCTTTTCAAATTACTAAACGGTG[C/T]
GTTTTTTTAAAATAAATTAAATAGGAAAATTGTTTTAAAAAATCATATTAATTCATTTTTGAAATTTAAAATAGTTAATACTTAATTAATCATGAGCTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.90%	29.80%	0.30%	0.00%	NA
All Indica	2759	90.70%	9.20%	0.14%	0.00%	NA
All Japonica	1512	48.60%	50.80%	0.60%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	83.50%	16.30%	0.22%	0.00%	NA
Indica Intermediate	786	87.90%	11.80%	0.25%	0.00%	NA
Temperate Japonica	767	47.70%	51.40%	0.91%	0.00%	NA
Tropical Japonica	504	65.30%	34.50%	0.20%	0.00%	NA
Japonica Intermediate	241	16.60%	83.00%	0.41%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0308212271	G -> A	LOC_Os03g15033.1	upstream_gene_variant ; 358.0bp to feature; MODIFIER	silent_mutation	Average:99.592; most accessible tissue: Callus, score: 99.867	N	N	N	N
vg0308212271	G -> A	LOC_Os03g15040.1	upstream_gene_variant ; 73.0bp to feature; MODIFIER	silent_mutation	Average:99.592; most accessible tissue: Callus, score: 99.867	N	N	N	N
vg0308212271	G -> A	LOC_Os03g15040.2	upstream_gene_variant ; 73.0bp to feature; MODIFIER	silent_mutation	Average:99.592; most accessible tissue: Callus, score: 99.867	N	N	N	N
vg0308212271	G -> A	LOC_Os03g15033-LOC_Os03g15040	intergenic_region ; MODIFIER	silent_mutation	Average:99.592; most accessible tissue: Callus, score: 99.867	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0308212271	G	A	-0.02	-0.02	-0.02	-0.02	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0308212271	NA	5.53E-09	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	2.38E-11	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	5.90E-09	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	3.47E-06	NA	mr1718	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	2.57E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	1.31E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	8.72E-06	mr1910	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	1.56E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	8.38E-09	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	1.94E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	1.61E-11	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	8.96E-08	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0308212271	NA	1.93E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251