\
| Variant ID: vg0307993242 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7993242 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACGCTCCATTGATTTGGGGCCGAGTTTTTCGCGTGCTAATAGTGAAGTACTGCAACGAGAGGGAGAGAGAGATGCAGAGGGGCAAAGGTGTAATTACACT[A/G]
CGTGCTATTGGTGTGGAGATGGCTGTGACCGTGAGCACAACGGTGAATTTCGCATGGGTGCATCAGGGCAATGCACGCTATTCACGCATCAAACCTAGTG
CACTAGGTTTGATGCGTGAATAGCGTGCATTGCCCTGATGCACCCATGCGAAATTCACCGTTGTGCTCACGGTCACAGCCATCTCCACACCAATAGCACG[T/C]
AGTGTAATTACACCTTTGCCCCTCTGCATCTCTCTCTCCCTCTCGTTGCAGTACTTCACTATTAGCACGCGAAAAACTCGGCCCCAAATCAATGGAGCGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 7.10% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 77.20% | 21.50% | 1.32% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.00% | 5.70% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 73.60% | 26.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.40% | 62.20% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307993242 | A -> G | LOC_Os03g14710.1 | upstream_gene_variant ; 4917.0bp to feature; MODIFIER | silent_mutation | Average:68.124; most accessible tissue: Callus, score: 97.897 | N | N | N | N |
| vg0307993242 | A -> G | LOC_Os03g14690.1 | downstream_gene_variant ; 3805.0bp to feature; MODIFIER | silent_mutation | Average:68.124; most accessible tissue: Callus, score: 97.897 | N | N | N | N |
| vg0307993242 | A -> G | LOC_Os03g14700.1 | intron_variant ; MODIFIER | silent_mutation | Average:68.124; most accessible tissue: Callus, score: 97.897 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307993242 | NA | 4.90E-13 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | 1.86E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | NA | 4.65E-07 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | 1.93E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | NA | 1.09E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | 8.69E-06 | 1.03E-08 | mr1566_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | NA | 5.80E-07 | mr1566_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | NA | 2.91E-07 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | NA | 1.81E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | NA | 7.83E-06 | mr1849_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | NA | 5.41E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | NA | 2.64E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | NA | 6.04E-12 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307993242 | NA | 1.25E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |