\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307992391:

Variant ID: vg0307992391 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 7992391
Reference Allele: TAAAAAlternative Allele: TAA,TTAAAAA,AAAAA,TA,T,TTAAAAAA
Primary Allele: TAAAASecondary Allele: TAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACCCATTCTGGGAGATTTTCTCCACATATTTTCTTCACGTCTTCGCGGTCGAGAGATGCAAGTGCATTGACATCTGCAGCCTGATACAGAATTTTTTT[TAAAA/TAA,TTAAAAA,AAAAA,TA,T,TTAAAAAA]
AAAAAAAAGTTAGCCACAAACCAATCTGTTTGCACCAAATAACGTCTCACTTATCATCACCATTTTATATCAACAGTATACAAATTCAACTAAACATAGA

Reverse complement sequence

TCTATGTTTAGTTGAATTTGTATACTGTTGATATAAAATGGTGATGATAAGTGAGACGTTATTTGGTGCAAACAGATTGGTTTGTGGCTAACTTTTTTTT[TTTTA/TTA,TTTTTAA,TTTTT,TA,A,TTTTTTAA]
AAAAAAATTCTGTATCAGGCTGCAGATGTCAATGCACTTGCATCTCTCGACCGCGAAGACGTGAAGAAAATATGTGGAGAAAATCTCCCAGAATGGGTGT

Allele Frequencies:

Populations Population SizeFrequency of TAAAA(primary allele) Frequency of TAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.50% 26.60% 6.41% 0.00% TTAAAAA: 8.17%; AAAAA: 7.49%; TA: 7.45%; T: 0.36%; TTAAAAAA: 0.02%
All Indica  2759 23.00% 43.30% 7.87% 0.00% TTAAAAA: 13.37%; TA: 12.25%; AAAAA: 0.14%; T: 0.07%; TTAAAAAA: 0.04%
All Japonica  1512 69.70% 2.90% 4.76% 0.00% AAAAA: 21.23%; T: 0.99%; TA: 0.26%; TTAAAAA: 0.13%
Aus  269 95.90% 2.60% 0.37% 0.00% TTAAAAA: 1.12%
Indica I  595 27.20% 50.80% 15.80% 0.00% TA: 6.05%; TTAAAAA: 0.17%
Indica II  465 14.20% 26.90% 11.18% 0.00% TA: 45.16%; TTAAAAA: 2.15%; AAAAA: 0.22%; TTAAAAAA: 0.22%
Indica III  913 19.30% 49.40% 1.31% 0.00% TTAAAAA: 28.15%; TA: 1.53%; AAAAA: 0.22%; T: 0.11%
Indica Intermediate  786 29.30% 40.20% 7.51% 0.00% TTAAAAA: 12.85%; TA: 9.92%; AAAAA: 0.13%; T: 0.13%
Temperate Japonica  767 66.60% 0.80% 6.00% 0.00% AAAAA: 24.25%; T: 1.69%; TA: 0.39%; TTAAAAA: 0.26%
Tropical Japonica  504 69.00% 7.30% 3.17% 0.00% AAAAA: 20.44%
Japonica Intermediate  241 80.90% 0.40% 4.15% 0.00% AAAAA: 13.28%; T: 0.83%; TA: 0.41%
VI/Aromatic  96 66.70% 3.10% 3.12% 0.00% AAAAA: 23.96%; TTAAAAA: 3.12%
Intermediate  90 48.90% 12.20% 11.11% 0.00% TA: 11.11%; TTAAAAA: 10.00%; AAAAA: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307992391 TAAAA -> TTAAAAAA LOC_Os03g14690.1 downstream_gene_variant ; 2955.0bp to feature; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> TTAAAAAA LOC_Os03g14700.1 intron_variant ; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> T LOC_Os03g14690.1 downstream_gene_variant ; 2955.0bp to feature; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> T LOC_Os03g14700.1 intron_variant ; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> TA LOC_Os03g14690.1 downstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> TA LOC_Os03g14700.1 intron_variant ; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> TAA LOC_Os03g14690.1 downstream_gene_variant ; 2957.0bp to feature; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> TAA LOC_Os03g14700.1 intron_variant ; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> AAAAA LOC_Os03g14690.1 downstream_gene_variant ; 2954.0bp to feature; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> AAAAA LOC_Os03g14700.1 intron_variant ; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> TTAAAAA LOC_Os03g14690.1 downstream_gene_variant ; 2955.0bp to feature; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N
vg0307992391 TAAAA -> TTAAAAA LOC_Os03g14700.1 intron_variant ; MODIFIER silent_mutation Average:38.79; most accessible tissue: Callus, score: 51.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307992391 5.01E-07 NA mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307992391 NA 1.62E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307992391 7.36E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307992391 NA 3.94E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307992391 1.21E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307992391 5.75E-08 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251