\
| Variant ID: vg0307948436 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7948436 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 295. )
GGCTAGTAAAAATGGGGGCACCGTGACATCCTGACCGAATTAATTTGAATTTAGTTTGTATGGACAATAAATACTGTGTACGCATATTTAGTATCACATG[C/T]
CATTTAAATAAGAGCGAAATCAACTTATAAGGACTTTTCTCTCCAACCATATTAAGTAGTGTAGTATGTGTGAGTGGATCCGCCCATCGGATGAGCATAT
ATATGCTCATCCGATGGGCGGATCCACTCACACATACTACACTACTTAATATGGTTGGAGAGAAAAGTCCTTATAAGTTGATTTCGCTCTTATTTAAATG[G/A]
CATGTGATACTAAATATGCGTACACAGTATTTATTGTCCATACAAACTAAATTCAAATTAATTCGGTCAGGATGTCACGGTGCCCCCATTTTTACTAGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 7.50% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 75.30% | 22.90% | 1.79% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.60% | 5.30% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 68.10% | 30.80% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 32.40% | 62.20% | 5.39% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307948436 | C -> T | LOC_Os03g14630.1 | upstream_gene_variant ; 1256.0bp to feature; MODIFIER | silent_mutation | Average:67.108; most accessible tissue: Zhenshan97 young leaf, score: 83.831 | N | N | N | N |
| vg0307948436 | C -> T | LOC_Os03g14630-LOC_Os03g14642 | intergenic_region ; MODIFIER | silent_mutation | Average:67.108; most accessible tissue: Zhenshan97 young leaf, score: 83.831 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307948436 | NA | 1.39E-11 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0307948436 | NA | 2.00E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | NA | 5.91E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | 6.90E-06 | NA | mr1120_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | NA | 6.11E-07 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | 1.33E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | NA | 6.49E-07 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | 1.06E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | NA | 6.54E-09 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | NA | 1.66E-07 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | NA | 9.32E-06 | mr1566_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | NA | 1.36E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | NA | 9.95E-07 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307948436 | NA | 1.91E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |