Variant ID: vg0307395283 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 7395283 |
Reference Allele: C | Alternative Allele: G |
Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, C: 0.05, others allele: 0.00, population size: 81. )
CAAGTTAAATGGACGATCCAAGGGATTAAAAGAGAGGGAATTACAATGAGACAAGATAGTTCACCCTCTAGAGAGGGAATGTGTGAATCTATTTCAAGTT[C/G]
TGCTAGGACCAAAATTCATTGAAAAATGAGATCCCCATACAAATAGATTCAAGTTCTCCACAAAAGTGACTAGTGTCCATCCATGAGTTGAAAGACCATT
AATGGTCTTTCAACTCATGGATGGACACTAGTCACTTTTGTGGAGAACTTGAATCTATTTGTATGGGGATCTCATTTTTCAATGAATTTTGGTCCTAGCA[G/C]
AACTTGAAATAGATTCACACATTCCCTCTCTAGAGGGTGAACTATCTTGTCTCATTGTAATTCCCTCTCTTTTAATCCCTTGGATCGTCCATTTAACTTG
Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 29.30% | 2.90% | 8.74% | 59.06% | NA |
All Indica | 2759 | 2.20% | 0.20% | 11.05% | 86.52% | NA |
All Japonica | 1512 | 84.90% | 8.20% | 0.07% | 6.81% | NA |
Aus | 269 | 1.10% | 0.00% | 38.66% | 60.22% | NA |
Indica I | 595 | 3.20% | 0.00% | 4.71% | 92.10% | NA |
Indica II | 465 | 2.40% | 0.40% | 3.44% | 93.76% | NA |
Indica III | 913 | 0.80% | 0.00% | 19.82% | 79.41% | NA |
Indica Intermediate | 786 | 3.20% | 0.40% | 10.18% | 86.26% | NA |
Temperate Japonica | 767 | 81.40% | 15.60% | 0.00% | 3.00% | NA |
Tropical Japonica | 504 | 85.30% | 0.20% | 0.20% | 14.29% | NA |
Japonica Intermediate | 241 | 95.40% | 1.20% | 0.00% | 3.32% | NA |
VI/Aromatic | 96 | 3.10% | 2.10% | 2.08% | 92.71% | NA |
Intermediate | 90 | 36.70% | 6.70% | 1.11% | 55.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0307395283 | C -> DEL | N | N | silent_mutation | Average:8.436; most accessible tissue: Callus, score: 38.937 | N | N | N | N |
vg0307395283 | C -> G | LOC_Os03g13680.1 | downstream_gene_variant ; 2502.0bp to feature; MODIFIER | silent_mutation | Average:8.436; most accessible tissue: Callus, score: 38.937 | N | N | N | N |
vg0307395283 | C -> G | LOC_Os03g13670.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.436; most accessible tissue: Callus, score: 38.937 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0307395283 | NA | 4.19E-07 | mr1171 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0307395283 | NA | 3.01E-07 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0307395283 | 4.80E-06 | 4.80E-06 | mr1655 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0307395283 | NA | 2.14E-09 | mr1712 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0307395283 | NA | 1.95E-07 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0307395283 | NA | 8.97E-08 | mr1946 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0307395283 | NA | 8.03E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |