\
| Variant ID: vg0307384335 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7384335 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCATTTATGGTATACATATATATTTGGCTAATCGGTGGTTTAGTCTATCAAATGGTTATGGAAGGATTATGGCTATATATGCATCTATCTAAATAGCAC[G/A]
GTTACATACCAGAGGTTCTCTTGTTAGATGGATTTAGGATCAATCAAATAATGAATCATTTGTATTATTATTTAATTGATGGAGGCTTTACTTTAATTAT
ATAATTAAAGTAAAGCCTCCATCAATTAAATAATAATACAAATGATTCATTATTTGATTGATCCTAAATCCATCTAACAAGAGAACCTCTGGTATGTAAC[C/T]
GTGCTATTTAGATAGATGCATATATAGCCATAATCCTTCCATAACCATTTGATAGACTAAACCACCGATTAGCCAAATATATATGTATACCATAAATGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307384335 | G -> A | LOC_Os03g13640.1 | downstream_gene_variant ; 2872.0bp to feature; MODIFIER | silent_mutation | Average:26.207; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| vg0307384335 | G -> A | LOC_Os03g13660.1 | downstream_gene_variant ; 4938.0bp to feature; MODIFIER | silent_mutation | Average:26.207; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| vg0307384335 | G -> A | LOC_Os03g13640-LOC_Os03g13660 | intergenic_region ; MODIFIER | silent_mutation | Average:26.207; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307384335 | 1.53E-06 | 8.42E-08 | mr1171 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307384335 | NA | 1.86E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307384335 | NA | 1.49E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307384335 | 8.74E-06 | 2.15E-07 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307384335 | NA | 1.55E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307384335 | NA | 3.94E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307384335 | NA | 3.48E-09 | mr1712 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307384335 | NA | 1.45E-07 | mr1946 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307384335 | NA | 9.23E-07 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307384335 | NA | 6.53E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307384335 | NA | 1.19E-06 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |