\
| Variant ID: vg0307269169 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7269169 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCTGACCGGTGTTGATCTTCTGGTTGGACCGCCCTGGAATCCCTGTCGCGCCTGTTGTCGCCGCCGGTCTGACCGCAGGTCACCCGCCGGTCTGACCGCC[G/A]
TAATGCCGCCGGTCTGACCACCGGTGTGTCGCCGATTAGACCGCAAAAACCCAGTGAAACACAAATCGAAGAACTCTAAAAGTGGATGACGACTTTATTG
CAATAAAGTCGTCATCCACTTTTAGAGTTCTTCGATTTGTGTTTCACTGGGTTTTTGCGGTCTAATCGGCGACACACCGGTGGTCAGACCGGCGGCATTA[C/T]
GGCGGTCAGACCGGCGGGTGACCTGCGGTCAGACCGGCGGCGACAACAGGCGCGACAGGGATTCCAGGGCGGTCCAACCAGAAGATCAACACCGGTCAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 34.00% | 5.04% | 0.04% | NA |
| All Indica | 2759 | 94.20% | 3.30% | 2.50% | 0.00% | NA |
| All Japonica | 1512 | 4.80% | 95.00% | 0.20% | 0.00% | NA |
| Aus | 269 | 29.00% | 11.90% | 58.36% | 0.74% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.30% | 5.90% | 3.83% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 2.70% | 4.20% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 97.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 10.30% | 89.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 9.40% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 41.10% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307269169 | G -> A | LOC_Os03g13430.1 | downstream_gene_variant ; 1632.0bp to feature; MODIFIER | silent_mutation | Average:31.118; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg0307269169 | G -> A | LOC_Os03g13430-LOC_Os03g13450 | intergenic_region ; MODIFIER | silent_mutation | Average:31.118; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| vg0307269169 | G -> DEL | N | N | silent_mutation | Average:31.118; most accessible tissue: Zhenshan97 root, score: 49.075 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307269169 | NA | 1.45E-07 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307269169 | NA | 2.58E-06 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307269169 | NA | 1.55E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307269169 | NA | 8.81E-10 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307269169 | NA | 2.60E-23 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307269169 | NA | 7.45E-13 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307269169 | NA | 9.98E-32 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307269169 | 2.64E-06 | NA | mr1928_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |