\
| Variant ID: vg0307012848 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 7012848 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 281. )
ATCCCCGAACTCTCCCAACGCCAAGAGATCGTGTCCAGTCCCTCCCCAAGCTGAACCGATCGAAGAAGGTCCCAAAGCTTGAGATATTCCAGTATTGCCT[G/A]
GATCCCCAGCGCCGCAGAGATGTCTCGAGTCCACCTCTTGTCTTGCAAAGCCTCAACCACCGTTCGCCTGTTCCGGAACCGAGCGGGAACAGCTGCGTAG
CTACGCAGCTGTTCCCGCTCGGTTCCGGAACAGGCGAACGGTGGTTGAGGCTTTGCAAGACAAGAGGTGGACTCGAGACATCTCTGCGGCGCTGGGGATC[C/T]
AGGCAATACTGGAATATCTCAAGCTTTGGGACCTTCTTCGATCGGTTCAGCTTGGGGAGGGACTGGACACGATCTCTTGGCGTTGGGAGAGTTCGGGGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 9.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 23.80% | 76.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0307012848 | G -> A | LOC_Os03g12980.1 | upstream_gene_variant ; 2325.0bp to feature; MODIFIER | silent_mutation | Average:66.969; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| vg0307012848 | G -> A | LOC_Os03g12980-LOC_Os03g12990 | intergenic_region ; MODIFIER | silent_mutation | Average:66.969; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0307012848 | 7.25E-06 | NA | mr1380 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307012848 | NA | 1.72E-06 | mr1380 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307012848 | 9.94E-07 | NA | mr1561 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307012848 | 8.70E-07 | 4.51E-10 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307012848 | NA | 5.75E-06 | mr1908 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307012848 | NA | 5.22E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307012848 | NA | 2.94E-10 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307012848 | NA | 3.09E-11 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307012848 | NA | 2.77E-07 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307012848 | NA | 1.07E-09 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0307012848 | NA | 9.24E-11 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |