\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307012848:

Variant ID: vg0307012848 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7012848
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCCCGAACTCTCCCAACGCCAAGAGATCGTGTCCAGTCCCTCCCCAAGCTGAACCGATCGAAGAAGGTCCCAAAGCTTGAGATATTCCAGTATTGCCT[G/A]
GATCCCCAGCGCCGCAGAGATGTCTCGAGTCCACCTCTTGTCTTGCAAAGCCTCAACCACCGTTCGCCTGTTCCGGAACCGAGCGGGAACAGCTGCGTAG

Reverse complement sequence

CTACGCAGCTGTTCCCGCTCGGTTCCGGAACAGGCGAACGGTGGTTGAGGCTTTGCAAGACAAGAGGTGGACTCGAGACATCTCTGCGGCGCTGGGGATC[C/T]
AGGCAATACTGGAATATCTCAAGCTTTGGGACCTTCTTCGATCGGTTCAGCTTGGGGAGGGACTGGACACGATCTCTTGGCGTTGGGAGAGTTCGGGGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 9.00% 0.00% 0.00% NA
All Indica  2759 94.00% 6.00% 0.00% 0.00% NA
All Japonica  1512 97.50% 2.50% 0.00% 0.00% NA
Aus  269 23.80% 76.20% 0.00% 0.00% NA
Indica I  595 91.40% 8.60% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 95.30% 4.70% 0.00% 0.00% NA
Indica Intermediate  786 91.30% 8.70% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307012848 G -> A LOC_Os03g12980.1 upstream_gene_variant ; 2325.0bp to feature; MODIFIER silent_mutation Average:66.969; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N
vg0307012848 G -> A LOC_Os03g12980-LOC_Os03g12990 intergenic_region ; MODIFIER silent_mutation Average:66.969; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307012848 7.25E-06 NA mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307012848 NA 1.72E-06 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307012848 9.94E-07 NA mr1561 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307012848 8.70E-07 4.51E-10 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307012848 NA 5.75E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307012848 NA 5.22E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307012848 NA 2.94E-10 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307012848 NA 3.09E-11 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307012848 NA 2.77E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307012848 NA 1.07E-09 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307012848 NA 9.24E-11 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251