Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0305905056:

Variant ID: vg0305905056 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 5905056
Reference Allele: T	Alternative Allele: A,TGA,TGAGAGA
Primary Allele: T	Secondary Allele: TGA

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

TGCACACCTGCACTGCAGAGAATGTTCCAAGTGTACTCCTGCTGATGCTGATGCTGCAGTTGCAGTCATGTGTCCCAAGTCCCAAAGTCATGTGTGTGTG[T/A,TGA,TGAGAGA]
GTGAGAGAGAGAAAAGATTTGATGACGAGATGGAAAGCGTTTTGTACTTTAGTACTTCTAGGAGAAGTACAGCAATGCATGCAGTGCAGTGCAGTGCACA

Reverse complement sequence

TGTGCACTGCACTGCACTGCATGCATTGCTGTACTTCTCCTAGAAGTACTAAAGTACAAAACGCTTTCCATCTCGTCATCAAATCTTTTCTCTCTCTCAC[A/T,TCA,TCTCTCA]
CACACACACATGACTTTGGGACTTGGGACACATGACTGCAACTGCAGCATCAGCATCAGCAGGAGTACACTTGGAACATTCTCTGCAGTGCAGGTGTGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of TGA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.00%	28.50%	0.28%	0.61%	A: 11.57%; TGAGAGA: 0.06%
All Indica	2759	40.30%	46.50%	0.43%	1.01%	A: 11.74%
All Japonica	1512	99.00%	0.50%	0.07%	0.00%	A: 0.33%; TGAGAGA: 0.07%
Aus	269	17.10%	11.50%	0.00%	0.00%	A: 71.38%
Indica I	595	16.10%	57.30%	1.18%	0.84%	A: 24.54%
Indica II	465	36.30%	58.10%	0.00%	1.29%	A: 4.30%
Indica III	913	57.30%	37.20%	0.11%	0.88%	A: 4.49%
Indica Intermediate	786	41.20%	42.20%	0.51%	1.15%	A: 14.89%
Temperate Japonica	767	98.30%	0.90%	0.13%	0.00%	A: 0.65%
Tropical Japonica	504	99.80%	0.00%	0.00%	0.00%	TGAGAGA: 0.20%
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	71.90%	6.20%	0.00%	0.00%	A: 21.88%
Intermediate	90	70.00%	21.10%	0.00%	1.11%	A: 5.56%; TGAGAGA: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0305905056	T -> A	LOC_Os03g11460.1	upstream_gene_variant ; 2647.0bp to feature; MODIFIER	silent_mutation	Average:86.92; most accessible tissue: Callus, score: 99.885	N	N	N	N
vg0305905056	T -> A	LOC_Os03g11450.1	downstream_gene_variant ; 2595.0bp to feature; MODIFIER	silent_mutation	Average:86.92; most accessible tissue: Callus, score: 99.885	N	N	N	N
vg0305905056	T -> A	LOC_Os03g11450-LOC_Os03g11460	intergenic_region ; MODIFIER	silent_mutation	Average:86.92; most accessible tissue: Callus, score: 99.885	N	N	N	N
vg0305905056	T -> DEL	N	N	silent_mutation	Average:86.92; most accessible tissue: Callus, score: 99.885	N	N	N	N
vg0305905056	T -> TGAGAGA	LOC_Os03g11460.1	upstream_gene_variant ; 2646.0bp to feature; MODIFIER	silent_mutation	Average:86.92; most accessible tissue: Callus, score: 99.885	N	N	N	N
vg0305905056	T -> TGAGAGA	LOC_Os03g11450.1	downstream_gene_variant ; 2596.0bp to feature; MODIFIER	silent_mutation	Average:86.92; most accessible tissue: Callus, score: 99.885	N	N	N	N
vg0305905056	T -> TGAGAGA	LOC_Os03g11450-LOC_Os03g11460	intergenic_region ; MODIFIER	silent_mutation	Average:86.92; most accessible tissue: Callus, score: 99.885	N	N	N	N
vg0305905056	T -> TGA	LOC_Os03g11460.1	upstream_gene_variant ; 2646.0bp to feature; MODIFIER	silent_mutation	Average:86.92; most accessible tissue: Callus, score: 99.885	N	N	N	N
vg0305905056	T -> TGA	LOC_Os03g11450.1	downstream_gene_variant ; 2596.0bp to feature; MODIFIER	silent_mutation	Average:86.92; most accessible tissue: Callus, score: 99.885	N	N	N	N
vg0305905056	T -> TGA	LOC_Os03g11450-LOC_Os03g11460	intergenic_region ; MODIFIER	silent_mutation	Average:86.92; most accessible tissue: Callus, score: 99.885	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0305905056	T	A	-0.04	-0.01	0.0	0.02	0.0	-0.01
vg0305905056	T	TGA	0.0	0.09	0.06	0.13	0.16	0.16
vg0305905056	T	TGAGA*	-0.07	0.12	0.12	0.12	0.23	0.32

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0305905056	NA	4.03E-08	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	9.32E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	5.20E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	1.61E-08	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	4.47E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	7.77E-06	mr1532	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	2.77E-08	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	8.76E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	7.02E-12	mr1706	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	1.73E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	1.07E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	1.74E-06	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	2.98E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	1.29E-07	1.34E-08	mr1172_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	1.68E-07	mr1359_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	1.87E-06	mr1520_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305905056	NA	8.87E-07	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251