\
| Variant ID: vg0305879043 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 5879043 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAATTGCCATTGGGATTGGTAACTCTGCCATGAAGATTGTTGCTGGGTTAGTTGAAAGTGTACGTTTTTGGTGTTTTCAGGTGTTTAGTGCTAGCTTCG[A/T]
GGAATGATCTTAGGTGCTTGTAGGATGGTGTTTTCAGTATGAACCCTTTCTTTAGTTGATGTGTATCTCTTTTTTATCAATGAAATGAGGCAGAACTTCT
AGAAGTTCTGCCTCATTTCATTGATAAAAAAGAGATACACATCAACTAAAGAAAGGGTTCATACTGAAAACACCATCCTACAAGCACCTAAGATCATTCC[T/A]
CGAAGCTAGCACTAAACACCTGAAAACACCAAAAACGTACACTTTCAACTAACCCAGCAACAATCTTCATGGCAGAGTTACCAATCCCAATGGCAATTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.10% | 4.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0305879043 | A -> T | LOC_Os03g11410.1 | downstream_gene_variant ; 4227.0bp to feature; MODIFIER | silent_mutation | Average:40.1; most accessible tissue: Callus, score: 79.199 | N | N | N | N |
| vg0305879043 | A -> T | LOC_Os03g11420.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.1; most accessible tissue: Callus, score: 79.199 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0305879043 | NA | 3.50E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | NA | 2.34E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | NA | 2.31E-06 | mr1474 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | NA | 2.31E-06 | mr1475 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | 1.60E-08 | 5.02E-49 | mr1549 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | 5.82E-09 | 1.40E-51 | mr1550 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | NA | 2.96E-46 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | NA | 4.10E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | NA | 7.74E-38 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | 6.47E-07 | 8.15E-54 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | 2.94E-06 | 2.30E-34 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0305879043 | NA | 1.52E-07 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |