\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305852353:

Variant ID: vg0305852353 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 5852353
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGGCACTGAAGGTTGCGGCCTAGAGCCGCCTACATGGAGTCGTCTTTGATCAGGCTAAAACGAATTGCTTGTTGGCTTCACGCCTTCCAACATCCATT[A/G]
AGGGAAGGAAGCCTCAAAAGAGGGAAGGCAGCGAAGCAATGTGATAGAGGACATCCCAAGGAATGGATGGAGATGAACAGGGAGTTGGACATAAAGGGGG

Reverse complement sequence

CCCCCTTTATGTCCAACTCCCTGTTCATCTCCATCCATTCCTTGGGATGTCCTCTATCACATTGCTTCGCTGCCTTCCCTCTTTTGAGGCTTCCTTCCCT[T/C]
AATGGATGTTGGAAGGCGTGAAGCCAACAAGCAATTCGTTTTAGCCTGATCAAAGACGACTCCATGTAGGCGGCTCTAGGCCGCAACCTTCAGTGCCTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 19.50% 0.08% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 41.10% 58.60% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 4.40% 95.60% 0.00% 0.00% NA
Tropical Japonica  504 91.70% 8.10% 0.20% 0.00% NA
Japonica Intermediate  241 52.30% 46.50% 1.24% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0305852353 A -> G LOC_Os03g11360.2 upstream_gene_variant ; 1553.0bp to feature; MODIFIER silent_mutation Average:59.667; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg0305852353 A -> G LOC_Os03g11360.1 upstream_gene_variant ; 1553.0bp to feature; MODIFIER silent_mutation Average:59.667; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg0305852353 A -> G LOC_Os03g11360.3 upstream_gene_variant ; 1553.0bp to feature; MODIFIER silent_mutation Average:59.667; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg0305852353 A -> G LOC_Os03g11350.1 downstream_gene_variant ; 1865.0bp to feature; MODIFIER silent_mutation Average:59.667; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg0305852353 A -> G LOC_Os03g11350-LOC_Os03g11360 intergenic_region ; MODIFIER silent_mutation Average:59.667; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0305852353 NA 7.49E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 5.66E-11 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 8.68E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 3.06E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 9.12E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 2.79E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 1.26E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 1.09E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 8.25E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 7.55E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 6.65E-25 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 2.78E-69 mr1241_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 3.20E-15 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 1.64E-20 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 2.60E-22 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 5.49E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 3.71E-46 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 3.23E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 7.92E-22 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 3.12E-32 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 2.93E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 5.79E-12 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353 NA 1.19E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251