Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305852353:

Variant ID: vg0305852353 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 5852353
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGGCACTGAAGGTTGCGGCCTAGAGCCGCCTACATGGAGTCGTCTTTGATCAGGCTAAAACGAATTGCTTGTTGGCTTCACGCCTTCCAACATCCATT[A/G]
AGGGAAGGAAGCCTCAAAAGAGGGAAGGCAGCGAAGCAATGTGATAGAGGACATCCCAAGGAATGGATGGAGATGAACAGGGAGTTGGACATAAAGGGGG

Reverse complement sequence

CCCCCTTTATGTCCAACTCCCTGTTCATCTCCATCCATTCCTTGGGATGTCCTCTATCACATTGCTTCGCTGCCTTCCCTCTTTTGAGGCTTCCTTCCCT[T/C]
AATGGATGTTGGAAGGCGTGAAGCCAACAAGCAATTCGTTTTAGCCTGATCAAAGACGACTCCATGTAGGCGGCTCTAGGCCGCAACCTTCAGTGCCTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.40%	19.50%	0.08%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	41.10%	58.60%	0.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	4.40%	95.60%	0.00%	0.00%	NA
Tropical Japonica	504	91.70%	8.10%	0.20%	0.00%	NA
Japonica Intermediate	241	52.30%	46.50%	1.24%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0305852353	A -> G	LOC_Os03g11360.2	upstream_gene_variant ; 1553.0bp to feature; MODIFIER	silent_mutation	Average:59.667; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg0305852353	A -> G	LOC_Os03g11360.1	upstream_gene_variant ; 1553.0bp to feature; MODIFIER	silent_mutation	Average:59.667; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg0305852353	A -> G	LOC_Os03g11360.3	upstream_gene_variant ; 1553.0bp to feature; MODIFIER	silent_mutation	Average:59.667; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg0305852353	A -> G	LOC_Os03g11350.1	downstream_gene_variant ; 1865.0bp to feature; MODIFIER	silent_mutation	Average:59.667; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg0305852353	A -> G	LOC_Os03g11350-LOC_Os03g11360	intergenic_region ; MODIFIER	silent_mutation	Average:59.667; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0305852353	NA	7.49E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	5.66E-11	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	8.68E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	3.06E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	9.12E-11	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	2.79E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	1.26E-12	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	1.09E-09	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	8.25E-16	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	7.55E-16	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	6.65E-25	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	2.78E-69	mr1241_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	3.20E-15	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	1.64E-20	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	2.60E-22	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	5.49E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	3.71E-46	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	3.23E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	7.92E-22	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	3.12E-32	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	2.93E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	5.79E-12	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305852353	NA	1.19E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251