Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0305233552:

Variant ID: vg0305233552 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 5233552
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TTGATTGGAAAATAATAGAAAAATTTAAAGAAGCCTCCCCACAATTAAAGAAGGAATTAAAGGAAGAAATACTTAAAGAATTAAAACAAGAAATGGATCA[T/G]
AAATTTGAACAAATAAAAAAGGCAGTAGATGAGAAATTAGAAGTTTCTTTTTCTAATCTGGACACTATGGATCTTGGTGGTCATGGGCAACCAGATGAAT

Reverse complement sequence

ATTCATCTGGTTGCCCATGACCACCAAGATCCATAGTGTCCAGATTAGAAAAAGAAACTTCTAATTTCTCATCTACTGCCTTTTTTATTTGTTCAAATTT[A/C]
TGATCCATTTCTTGTTTTAATTCTTTAAGTATTTCTTCCTTTAATTCCTTCTTTAATTGTGGGGAGGCTTCTTTAAATTTTTCTATTATTTTCCAATCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.20%	17.30%	24.93%	20.57%	NA
All Indica	2759	4.40%	21.20%	39.98%	34.40%	NA
All Japonica	1512	99.50%	0.10%	0.33%	0.00%	NA
Aus	269	1.10%	81.00%	11.90%	5.95%	NA
Indica I	595	4.90%	8.60%	43.19%	43.36%	NA
Indica II	465	7.50%	7.70%	38.71%	46.02%	NA
Indica III	913	2.40%	37.70%	38.23%	21.69%	NA
Indica Intermediate	786	4.60%	19.60%	40.33%	35.50%	NA
Temperate Japonica	767	99.60%	0.10%	0.26%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.40%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	74.00%	7.30%	18.75%	0.00%	NA
Intermediate	90	62.20%	7.80%	22.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0305233552	T -> DEL	LOC_Os03g10270.1	N	frameshift_variant	Average:9.199; most accessible tissue: Zhenshan97 flower, score: 17.42	N	N	N	N
vg0305233552	T -> G	LOC_Os03g10270.1	missense_variant ; p.His164Gln; MODERATE	nonsynonymous_codon ; H164Q	Average:9.199; most accessible tissue: Zhenshan97 flower, score: 17.42	probably damaging	-2.213	TOLERATED	0.79

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0305233552	NA	3.09E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0305233552	NA	1.25E-06	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	3.22E-32	mr1333	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	8.79E-08	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	3.80E-07	1.46E-23	mr1518	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	9.59E-07	6.81E-10	mr1518	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	3.82E-41	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	1.42E-32	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	3.70E-07	3.62E-25	mr1676	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	5.00E-07	1.66E-11	mr1676	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	3.43E-36	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	2.03E-28	mr1686	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	2.02E-20	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	3.23E-13	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	1.36E-34	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	3.57E-06	mr1181_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	2.47E-24	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	2.24E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	1.22E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	3.29E-16	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	6.79E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	1.61E-36	mr1541_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	7.27E-19	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	4.45E-08	2.77E-28	mr1676_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	1.53E-09	7.17E-16	mr1676_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	5.23E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	3.48E-06	mr1768_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	1.90E-18	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	3.69E-30	mr1891_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0305233552	NA	3.11E-23	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251