\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0304690506:

Variant ID: vg0304690506 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 4690506
Reference Allele: TGAlternative Allele: AG,T
Primary Allele: AGSecondary Allele: TG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATCTCATCTGCACTGGTTTTGACAGTTGAGGGACGTGTTGTATCTGGTTTTCCGGTTGAAGGACGAAAATCGGATTCGTTGACAAGTTAAGGAATATA[TG/AG,T]
ATGAACTTATTTCTTTTGCCGTTCGGTTCGATTGATTGGGTCAGGCCCATCATCTGGGCTTATGGATAGGCCGCGTTGGCGTTGGCGTACGTACTTCCGG

Reverse complement sequence

CCGGAAGTACGTACGCCAACGCCAACGCGGCCTATCCATAAGCCCAGATGATGGGCCTGACCCAATCAATCGAACCGAACGGCAAAAGAAATAAGTTCAT[CA/CT,A]
TATATTCCTTAACTTGTCAACGAATCCGATTTTCGTCCTTCAACCGGAAAACCAGATACAACACGTCCCTCAACTGTCAAAACCAGTGCAGATGAGATCC

Allele Frequencies:

Populations Population SizeFrequency of AG(primary allele) Frequency of TG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.30% 28.80% 0.76% 0.19% T: 0.02%
All Indica  2759 96.80% 1.50% 1.30% 0.33% T: 0.04%
All Japonica  1512 15.90% 84.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 95.30% 0.00% 3.61% 0.99% T: 0.11%
Indica Intermediate  786 98.30% 1.30% 0.38% 0.00% NA
Temperate Japonica  767 4.30% 95.70% 0.00% 0.00% NA
Tropical Japonica  504 14.70% 85.30% 0.00% 0.00% NA
Japonica Intermediate  241 55.60% 44.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0304690506 TG -> T LOC_Os03g09040.1 upstream_gene_variant ; 2106.0bp to feature; MODIFIER silent_mutation Average:99.319; most accessible tissue: Zhenshan97 panicle, score: 99.704 N N N N
vg0304690506 TG -> T LOC_Os03g09045.1 upstream_gene_variant ; 4307.0bp to feature; MODIFIER silent_mutation Average:99.319; most accessible tissue: Zhenshan97 panicle, score: 99.704 N N N N
vg0304690506 TG -> T LOC_Os03g09030.1 downstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:99.319; most accessible tissue: Zhenshan97 panicle, score: 99.704 N N N N
vg0304690506 TG -> T LOC_Os03g09030-LOC_Os03g09040 intergenic_region ; MODIFIER silent_mutation Average:99.319; most accessible tissue: Zhenshan97 panicle, score: 99.704 N N N N
vg0304690506 TG -> DEL N N silent_mutation Average:99.319; most accessible tissue: Zhenshan97 panicle, score: 99.704 N N N N
vg0304690506 TG -> AG LOC_Os03g09040.1 upstream_gene_variant ; 2107.0bp to feature; MODIFIER silent_mutation Average:99.319; most accessible tissue: Zhenshan97 panicle, score: 99.704 N N N N
vg0304690506 TG -> AG LOC_Os03g09045.1 upstream_gene_variant ; 4308.0bp to feature; MODIFIER silent_mutation Average:99.319; most accessible tissue: Zhenshan97 panicle, score: 99.704 N N N N
vg0304690506 TG -> AG LOC_Os03g09030.1 downstream_gene_variant ; 437.0bp to feature; MODIFIER silent_mutation Average:99.319; most accessible tissue: Zhenshan97 panicle, score: 99.704 N N N N
vg0304690506 TG -> AG LOC_Os03g09030-LOC_Os03g09040 intergenic_region ; MODIFIER silent_mutation Average:99.319; most accessible tissue: Zhenshan97 panicle, score: 99.704 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0304690506 TG AG 0.01 0.04 0.02 0.01 0.01 0.03
vg0304690506 TG T -0.01 -0.01 0.02 -0.01 0.01 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0304690506 NA 7.99E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 2.18E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 6.08E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 7.29E-17 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 5.70E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 7.88E-08 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 6.80E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 9.09E-22 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 4.33E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.36E-37 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 9.54E-24 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 6.47E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 2.00E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.96E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 2.57E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 7.39E-29 mr1917 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.97E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 3.07E-37 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.45E-18 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.24E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 8.93E-09 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 2.49E-16 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 2.05E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 8.37E-09 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 8.92E-07 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.91E-08 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 6.19E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 2.63E-19 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 2.39E-09 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.70E-27 mr1242_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 6.50E-08 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.53E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 6.23E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.66E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.33E-49 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 5.59E-23 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 4.47E-17 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.28E-10 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 6.47E-46 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 3.38E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.43E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.55E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0304690506 NA 1.55E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251