Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0303955124:

Variant ID: vg0303955124 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 3955124
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCACTATCTCGCTCCCTTGTTTCTCGTGCCCACGCTTCCACTAATCCCATTCGCCCGCTTGCGACGCATGAGGTGGATATGCGGTTGTGGCAGTCGAG[G/A]
CAGATCGTATCGTGCGCGCGTTAATTACGCTCGCCGATCGAAGCGACGTTGCCATATCTCCAGGCGAAGCAAATCGGCTCGCCCAGATTCGTGCGCTGCT

Reverse complement sequence

AGCAGCGCACGAATCTGGGCGAGCCGATTTGCTTCGCCTGGAGATATGGCAACGTCGCTTCGATCGGCGAGCGTAATTAACGCGCGCACGATACGATCTG[C/T]
CTCGACTGCCACAACCGCATATCCACCTCATGCGTCGCAAGCGGGCGAATGGGATTAGTGGAAGCGTGGGCACGAGAAACAAGGGAGCGAGATAGTGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.30%	0.90%	26.89%	17.92%	NA
All Indica	2759	51.60%	1.50%	31.10%	15.84%	NA
All Japonica	1512	62.60%	0.10%	14.48%	22.82%	NA
Aus	269	21.90%	0.00%	61.34%	16.73%	NA
Indica I	595	39.80%	2.20%	29.08%	28.91%	NA
Indica II	465	38.30%	3.00%	44.30%	14.41%	NA
Indica III	913	64.80%	0.40%	27.82%	6.90%	NA
Indica Intermediate	786	52.90%	1.30%	28.63%	17.18%	NA
Temperate Japonica	767	92.80%	0.10%	1.69%	5.35%	NA
Tropical Japonica	504	9.10%	0.00%	37.70%	53.17%	NA
Japonica Intermediate	241	78.40%	0.00%	6.64%	14.94%	NA
VI/Aromatic	96	89.60%	0.00%	8.33%	2.08%	NA
Intermediate	90	56.70%	0.00%	23.33%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0303955124	G -> A	LOC_Os03g07780.1	upstream_gene_variant ; 306.0bp to feature; MODIFIER	silent_mutation	Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0303955124	G -> A	LOC_Os03g07770.1	downstream_gene_variant ; 4172.0bp to feature; MODIFIER	silent_mutation	Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0303955124	G -> A	LOC_Os03g07780-LOC_Os03g07790	intergenic_region ; MODIFIER	silent_mutation	Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0303955124	G -> DEL	N	N	silent_mutation	Average:33.791; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0303955124	NA	5.87E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303955124	NA	7.63E-10	mr1742	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303955124	NA	3.60E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303955124	NA	1.54E-08	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303955124	NA	9.53E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303955124	NA	7.47E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251