Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0303857837:

Variant ID: vg0303857837 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 3857837
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:

TCATCCTTGTAATCCAGATCTCAACATTTTAGTTGGAAAAGGTGGTCTGCATGGTAATGTCTTCAGGATAAAACCACCAATGTGCTTTACAAGGGATGAT[G/A]
CAGGTTCGTATGAACTGTCTCAAACAAAACTTTGCCATTACTGCATTGCCCATAGAGTAACTAAAGGAAATTCTACTTTCATGCAGATTACCTGGTGGAT

Reverse complement sequence

ATCCACCAGGTAATCTGCATGAAAGTAGAATTTCCTTTAGTTACTCTATGGGCAATGCAGTAATGGCAAAGTTTTGTTTGAGACAGTTCATACGAACCTG[C/T]
ATCATCCCTTGTAAAGCACATTGGTGGTTTTATCCTGAAGACATTACCATGCAGACCACCTTTTCCAACTAAAATGTTGAGATCTGGATTACAAGGATGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.70%	1.30%	1.04%	0.00%	NA
All Indica	2759	96.00%	2.20%	1.78%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	88.70%	7.40%	3.87%	0.00%	NA
Indica II	465	97.00%	0.40%	2.58%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.20%	2.00%	1.78%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0303857837	G -> A	LOC_Os03g07570.1	missense_variant ; p.Ala472Thr; MODERATE	nonsynonymous_codon ; A472T	Average:68.888; most accessible tissue: Zhenshan97 young leaf, score: 80.325	possibly damaging	1.742	DELETERIOUS	0.01
vg0303857837	G -> A	LOC_Os03g07570.4	missense_variant ; p.Ala472Thr; MODERATE	nonsynonymous_codon ; A472T	Average:68.888; most accessible tissue: Zhenshan97 young leaf, score: 80.325	possibly damaging	1.742	DELETERIOUS	0.01
vg0303857837	G -> A	LOC_Os03g07570.3	missense_variant ; p.Ala292Thr; MODERATE	nonsynonymous_codon ; A292T	Average:68.888; most accessible tissue: Zhenshan97 young leaf, score: 80.325	possibly damaging	1.742	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0303857837	5.45E-12	2.04E-20	mr1038	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303857837	1.64E-06	7.78E-09	mr1141	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303857837	1.17E-12	7.76E-23	mr1389	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303857837	1.12E-09	2.68E-19	mr1038_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303857837	9.83E-11	1.88E-21	mr1389_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251