\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303477436:

Variant ID: vg0303477436 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3477436
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TACTGACTGCGTCCATCGTGTGTGTGAAACTCTGATTAGTCCATGTAGCAACTCGATCTTGACTCCGACCGTGCGGCCTTGAAATCTTGAATTGATATAC[G/A]
TACCTATACGTTCGTTCGTTCGTTTCGATCAAATCGACCACATGAATTCATTCCTCGATCGTAACGGCTGCGACTACTTCGACAGTTCGACCAATTTACT

Reverse complement sequence

AGTAAATTGGTCGAACTGTCGAAGTAGTCGCAGCCGTTACGATCGAGGAATGAATTCATGTGGTCGATTTGATCGAAACGAACGAACGAACGTATAGGTA[C/T]
GTATATCAATTCAAGATTTCAAGGCCGCACGGTCGGAGTCAAGATCGAGTTGCTACATGGACTAATCAGAGTTTCACACACACGATGGACGCAGTCAGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 27.40% 0.30% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 19.60% 79.40% 0.93% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 16.70% 81.60% 1.69% 0.00% NA
Tropical Japonica  504 10.90% 88.90% 0.20% 0.00% NA
Japonica Intermediate  241 47.30% 52.70% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303477436 G -> A LOC_Os03g06860.1 upstream_gene_variant ; 3848.0bp to feature; MODIFIER silent_mutation Average:74.437; most accessible tissue: Callus, score: 96.34 N N N N
vg0303477436 G -> A LOC_Os03g06870.1 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:74.437; most accessible tissue: Callus, score: 96.34 N N N N
vg0303477436 G -> A LOC_Os03g06880.1 upstream_gene_variant ; 1975.0bp to feature; MODIFIER silent_mutation Average:74.437; most accessible tissue: Callus, score: 96.34 N N N N
vg0303477436 G -> A LOC_Os03g06870-LOC_Os03g06880 intergenic_region ; MODIFIER silent_mutation Average:74.437; most accessible tissue: Callus, score: 96.34 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303477436 NA 1.29E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0303477436 NA 3.82E-09 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 2.91E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 4.89E-09 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 4.22E-06 4.22E-06 mr1297 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 2.05E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 5.57E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 2.84E-06 mr1510 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 3.92E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 1.83E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 5.20E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 6.10E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 1.70E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 8.14E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436 NA 3.82E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251