Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0303477436:

Variant ID: vg0303477436 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 3477436
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TACTGACTGCGTCCATCGTGTGTGTGAAACTCTGATTAGTCCATGTAGCAACTCGATCTTGACTCCGACCGTGCGGCCTTGAAATCTTGAATTGATATAC[G/A]
TACCTATACGTTCGTTCGTTCGTTTCGATCAAATCGACCACATGAATTCATTCCTCGATCGTAACGGCTGCGACTACTTCGACAGTTCGACCAATTTACT

Reverse complement sequence

AGTAAATTGGTCGAACTGTCGAAGTAGTCGCAGCCGTTACGATCGAGGAATGAATTCATGTGGTCGATTTGATCGAAACGAACGAACGAACGTATAGGTA[C/T]
GTATATCAATTCAAGATTTCAAGGCCGCACGGTCGGAGTCAAGATCGAGTTGCTACATGGACTAATCAGAGTTTCACACACACGATGGACGCAGTCAGTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	27.40%	0.30%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.00%	0.00%	NA
All Japonica	1512	19.60%	79.40%	0.93%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	95.50%	4.50%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	16.70%	81.60%	1.69%	0.00%	NA
Tropical Japonica	504	10.90%	88.90%	0.20%	0.00%	NA
Japonica Intermediate	241	47.30%	52.70%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0303477436	G -> A	LOC_Os03g06860.1	upstream_gene_variant ; 3848.0bp to feature; MODIFIER	silent_mutation	Average:74.437; most accessible tissue: Callus, score: 96.34	N	N	N	N
vg0303477436	G -> A	LOC_Os03g06870.1	upstream_gene_variant ; 608.0bp to feature; MODIFIER	silent_mutation	Average:74.437; most accessible tissue: Callus, score: 96.34	N	N	N	N
vg0303477436	G -> A	LOC_Os03g06880.1	upstream_gene_variant ; 1975.0bp to feature; MODIFIER	silent_mutation	Average:74.437; most accessible tissue: Callus, score: 96.34	N	N	N	N
vg0303477436	G -> A	LOC_Os03g06870-LOC_Os03g06880	intergenic_region ; MODIFIER	silent_mutation	Average:74.437; most accessible tissue: Callus, score: 96.34	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0303477436	NA	1.29E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0303477436	NA	3.82E-09	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	2.91E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	4.89E-09	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	4.22E-06	4.22E-06	mr1297	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	2.05E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	5.57E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	2.84E-06	mr1510	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	3.92E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	1.83E-12	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	5.20E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	6.10E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	1.70E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	8.14E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303477436	NA	3.82E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251