\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0303252106:

Variant ID: vg0303252106 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 3252106
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCAAAATGCCATTTTGGACAAAAATGACCCTGGTTCTTCTCCCTTCCTCCAATACCAATGTCGGAGGAGCTCGTCGGCAGCCACCGGTGCCACCTTGTC[A/G]
GCGACGATGGGGGCGCTGCCCTCCTCGTCGTCCCCACCTTTTCATTATGCCCGCCGCGCTAAGAGGAGGCCATAGCCGACGTCATCAACGTTGATGGGGC

Reverse complement sequence

GCCCCATCAACGTTGATGACGTCGGCTATGGCCTCCTCTTAGCGCGGCGGGCATAATGAAAAGGTGGGGACGACGAGGAGGGCAGCGCCCCCATCGTCGC[T/C]
GACAAGGTGGCACCGGTGGCTGCCGACGAGCTCCTCCGACATTGGTATTGGAGGAAGGGAGAAGAACCAGGGTCATTTTTGTCCAAAATGGCATTTTGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 37.90% 1.52% 1.86% NA
All Indica  2759 87.70% 7.20% 2.25% 2.90% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 95.80% 2.70% 1.34% 0.17% NA
Indica II  465 88.60% 3.70% 2.15% 5.59% NA
Indica III  913 89.40% 5.00% 2.19% 3.40% NA
Indica Intermediate  786 79.00% 15.10% 3.05% 2.80% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 42.70% 43.80% 6.25% 7.29% NA
Intermediate  90 48.90% 46.70% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0303252106 A -> DEL N N silent_mutation Average:81.722; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0303252106 A -> G LOC_Os03g06490.1 upstream_gene_variant ; 881.0bp to feature; MODIFIER silent_mutation Average:81.722; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N
vg0303252106 A -> G LOC_Os03g06480-LOC_Os03g06490 intergenic_region ; MODIFIER silent_mutation Average:81.722; most accessible tissue: Minghui63 panicle, score: 92.666 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0303252106 A G -0.04 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0303252106 NA 1.95E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303252106 NA 6.41E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303252106 NA 2.44E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303252106 8.64E-07 8.64E-07 mr1449 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303252106 NA 5.33E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303252106 NA 5.83E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303252106 NA 2.73E-16 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303252106 NA 1.19E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0303252106 NA 1.33E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251