Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0302217186:

Variant ID: vg0302217186 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 2217186
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.11, T: 0.06, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AACTGTCGGTCTATTATTTATCACTAGAAGAGCCGCTGGTCATTTTAAGGGCATGTTTAGTTCCTAAAAACTTTTCTCAAAAACATCACATCGAATCTTT[A/G]
AATACATATATGGAGCATTAAATATAGATAAAAAGAAAAACTAATTGCACAGTGTGCATGTAAATAGCGAGACGAATCTTTTGAGCCTAATTAGTCCATG

Reverse complement sequence

CATGGACTAATTAGGCTCAAAAGATTCGTCTCGCTATTTACATGCACACTGTGCAATTAGTTTTTCTTTTTATCTATATTTAATGCTCCATATATGTATT[T/C]
AAAGATTCGATGTGATGTTTTTGAGAAAAGTTTTTAGGAACTAAACATGCCCTTAAAATGACCAGCGGCTCTTCTAGTGATAAATAATAGACCGACAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 32.80% 1.06% 17.44% NA
All Indica  2759 25.90% 46.80% 1.30% 25.99% NA
All Japonica  1512 99.20% 0.60% 0.07% 0.13% NA
Aus  269 3.70% 65.80% 3.35% 27.14% NA
Indica I  595 43.40% 15.50% 1.68% 39.50% NA
Indica II  465 18.30% 76.60% 1.72% 3.44% NA
Indica III  913 20.60% 47.50% 0.99% 30.89% NA
Indica Intermediate  786 23.40% 52.00% 1.15% 23.41% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.41% 0.41% NA
VI/Aromatic  96 37.50% 41.70% 1.04% 19.79% NA
Intermediate  90 46.70% 35.60% 3.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0302217186 A -> DEL N N silent_mutation Average:57.459; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0302217186 A -> G LOC_Os03g04660.1 downstream_gene_variant ; 3245.0bp to feature; MODIFIER silent_mutation Average:57.459; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0302217186 A -> G LOC_Os03g04670.1 downstream_gene_variant ; 1414.0bp to feature; MODIFIER silent_mutation Average:57.459; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0302217186 A -> G LOC_Os03g04660-LOC_Os03g04670 intergenic_region ; MODIFIER silent_mutation Average:57.459; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0302217186 NA 1.84E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 NA 4.35E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 NA 1.16E-23 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 NA 3.90E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 NA 8.74E-09 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 NA 3.71E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 4.59E-06 NA mr1911 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 4.61E-06 NA mr1961 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 NA 9.59E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 NA 3.72E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 NA 9.16E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302217186 NA 3.93E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251