Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0301440928:

Variant ID: vg0301440928 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 1440928
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCACGGTATGTCTTACGGTTACCGCGCGGTAACCATCTTACCGCGGGAGTTCGGTAACCGTATTAAAAACGGTAAGGGGAACCCTACTACTTTTACTCA[G/A]
AACCTTAGATGCTACTCAGATCACTATAACCACTGGGCTATATGACTATTTACGAAGCCCTACTACTATCCCCCTTGATTATACTCGCAAGAAGAGACAT

Reverse complement sequence

ATGTCTCTTCTTGCGAGTATAATCAAGGGGGATAGTAGTAGGGCTTCGTAAATAGTCATATAGCCCAGTGGTTATAGTGATCTGAGTAGCATCTAAGGTT[C/T]
TGAGTAAAAGTAGTAGGGTTCCCCTTACCGTTTTTAATACGGTTACCGAACTCCCGCGGTAAGATGGTTACCGCGCGGTAACCGTAAGACATACCGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.90%	22.00%	0.06%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.00%	0.00%	NA
All Japonica	1512	40.40%	59.60%	0.00%	0.00%	NA
Aus	269	79.90%	19.70%	0.37%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	54.50%	45.50%	0.00%	0.00%	NA
Tropical Japonica	504	19.80%	80.20%	0.00%	0.00%	NA
Japonica Intermediate	241	38.60%	61.40%	0.00%	0.00%	NA
VI/Aromatic	96	53.10%	46.90%	0.00%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0301440928	G -> A	LOC_Os03g03370.1	upstream_gene_variant ; 1730.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0301440928	G -> A	LOC_Os03g03390.1	upstream_gene_variant ; 4068.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0301440928	G -> A	LOC_Os03g03370.2	upstream_gene_variant ; 1730.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0301440928	G -> A	LOC_Os03g03370-LOC_Os03g03390	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0301440928	G	A	0.02	-0.01	-0.02	-0.02	-0.01	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0301440928	NA	4.15E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	5.24E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	2.80E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	2.62E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	3.88E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	4.39E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	4.39E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	9.35E-06	3.97E-08	mr1812	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	7.46E-07	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	4.76E-06	NA	mr1880	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	2.20E-09	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	4.52E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	1.39E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301440928	NA	2.68E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251