\
| Variant ID: vg0301371740 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 1371740 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 93. )
GCAAATACCACGATTTCATGCGTATCAGGGGTCGGGAATGCTTCGCCGAATGCCGGTCGCCACCCGATGATCTCCTTTGCTAGAAGAACGCCGTGCGCCA[A/C]
CATCTCCTTCAGATTATCTTCCGTCACATCAGAGGGCGCCCACTGACTCTCGAAGCTTTCTCTTTTTTCCGCCATGAATGTGGACTGGATGGTTTGATTT
AAATCAAACCATCCAGTCCACATTCATGGCGGAAAAAAGAGAAAGCTTCGAGAGTCAGTGGGCGCCCTCTGATGTGACGGAAGATAATCTGAAGGAGATG[T/G]
TGGCGCACGGCGTTCTTCTAGCAAAGGAGATCATCGGGTGGCGACCGGCATTCGGCGAAGCATTCCCGACCCCTGATACGCATGAAATCGTGGTATTTGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.70% | 19.30% | 1.84% | 48.18% | NA |
| All Indica | 2759 | 3.20% | 14.40% | 2.75% | 79.63% | NA |
| All Japonica | 1512 | 84.30% | 15.40% | 0.00% | 0.26% | NA |
| Aus | 269 | 18.60% | 73.60% | 1.86% | 5.95% | NA |
| Indica I | 595 | 4.00% | 9.90% | 2.02% | 84.03% | NA |
| Indica II | 465 | 7.10% | 10.30% | 3.44% | 79.14% | NA |
| Indica III | 913 | 0.80% | 18.50% | 1.97% | 78.75% | NA |
| Indica Intermediate | 786 | 3.20% | 15.40% | 3.82% | 77.61% | NA |
| Temperate Japonica | 767 | 94.70% | 5.20% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 69.60% | 30.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 82.20% | 17.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 8.30% | 60.40% | 0.00% | 31.25% | NA |
| Intermediate | 90 | 31.10% | 28.90% | 6.67% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0301371740 | A -> C | LOC_Os03g03220.1 | missense_variant ; p.Leu26Val; MODERATE | nonsynonymous_codon ; L26V | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign |
-0.139 |
TOLERATED | 1.00 |
| vg0301371740 | A -> DEL | LOC_Os03g03220.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0301371740 | NA | 6.15E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 2.93E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 3.33E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 8.18E-07 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 8.17E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 7.15E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 9.83E-06 | mr1485 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 2.61E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 2.52E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 3.44E-06 | mr1759 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 9.91E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | NA | 6.32E-07 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371740 | 1.69E-06 | 2.77E-08 | mr1979 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |