\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0300483843:

Variant ID: vg0300483843 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 483843
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ACTACTCCCTCCGTTTCAAAATGTTTGACACCGTTGACTTTTTAGTACGTGTTTGACCATTCGTCTTATTCAAAAAATTTAAGTAATTATTTATTCTTTT[C/T]
ATATCATTTGATTCATTGTTGAATATACTTTCATGTACTCATATAGTTTTACATATTTCACAATTTTTTTTTGAATAAGACGAATGGTTAAACATGTGCT

Reverse complement sequence

AGCACATGTTTAACCATTCGTCTTATTCAAAAAAAAATTGTGAAATATGTAAAACTATATGAGTACATGAAAGTATATTCAACAATGAATCAAATGATAT[G/A]
AAAAGAATAAATAATTACTTAAATTTTTTGAATAAGACGAATGGTCAAACACGTACTAAAAAGTCAACGGTGTCAAACATTTTGAAACGGAGGGAGTAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 13.50% 0.11% 0.00% NA
All Indica  2759 78.40% 21.50% 0.14% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 75.80% 24.20% 0.00% 0.00% NA
Indica II  465 64.50% 35.30% 0.22% 0.00% NA
Indica III  913 88.00% 11.90% 0.11% 0.00% NA
Indica Intermediate  786 77.40% 22.40% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0300483843 C -> T LOC_Os03g01780.1 upstream_gene_variant ; 1428.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0300483843 C -> T LOC_Os03g01790.1 upstream_gene_variant ; 4646.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0300483843 C -> T LOC_Os03g01760.1 downstream_gene_variant ; 1835.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0300483843 C -> T LOC_Os03g01760.2 downstream_gene_variant ; 1835.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0300483843 C -> T LOC_Os03g01770.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0300483843 NA 8.48E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 1.45E-08 mr1164_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 2.34E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 3.42E-06 4.91E-10 mr1327_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 6.70E-06 1.48E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 2.25E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 2.55E-06 1.27E-11 mr1380_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 3.29E-06 2.47E-12 mr1380_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 8.17E-06 2.28E-09 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 8.51E-06 5.53E-11 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 1.48E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 1.17E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 1.07E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 3.11E-08 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 7.64E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 2.99E-08 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 8.71E-06 3.78E-10 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 3.28E-07 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 2.72E-08 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300483843 NA 3.99E-09 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251