\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235867717:

Variant ID: vg0235867717 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35867717
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCCTCAATCCATTTGGAGAATTTGTCGATAGCCACAAAGAGATGCGTGTAACCGCCAACTGCCCTTTTAAACGGGCCGACCATGTCAAGCCCCCAGACC[G/A]
CGAACGGCCAGGACAACGGGATGGTTTGCAACTCTTGGGCTGGCAAATGAGTTTGTCTGGCAAAAAATTGACAACCTTCGCATGTCCGCACAATCTTGTC

Reverse complement sequence

GACAAGATTGTGCGGACATGCGAAGGTTGTCAATTTTTTGCCAGACAAACTCATTTGCCAGCCCAAGAGTTGCAAACCATCCCGTTGTCCTGGCCGTTCG[C/T]
GGTCTGGGGGCTTGACATGGTCGGCCCGTTTAAAAGGGCAGTTGGCGGTTACACGCATCTCTTTGTGGCTATCGACAAATTCTCCAAATGGATTGAGGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 6.70% 0.80% 0.00% NA
All Indica  2759 99.70% 0.20% 0.07% 0.00% NA
All Japonica  1512 78.10% 20.20% 1.72% 0.00% NA
Aus  269 97.80% 0.00% 2.23% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.40% 0.11% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 96.70% 2.70% 0.52% 0.00% NA
Tropical Japonica  504 44.00% 53.00% 2.98% 0.00% NA
Japonica Intermediate  241 90.00% 7.10% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 4.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235867717 G -> A LOC_Os02g58710.1 missense_variant ; p.Ala1184Val; MODERATE nonsynonymous_codon ; A1184V Average:26.277; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 benign 0.572 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235867717 NA 1.27E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235867717 NA 2.55E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235867717 NA 3.73E-09 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235867717 NA 6.29E-11 mr1676 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235867717 NA 1.59E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235867717 NA 4.86E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235867717 NA 2.54E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235867717 NA 9.38E-14 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251