Variant ID: vg0235431697 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 35431697 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 227. )
CGCCAACAGTTTCGGGCACTCTGGCTGAACCCAAATCTGCAATACATACCAGCAATAAAGGATGTAGATTAAGTTGAGAATGAGGGACAAATAACCTGAG[A/T]
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGTCTTGGTTAAACTAATTACCTTTTCACTTCCGAAGTTGAGGTACAGGTCGCTTAT
ATAAGCGACCTGTACCTCAACTTCGGAAGTGAAAAGGTAATTAGTTTAACCAAGACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC[T/A]
CTCAGGTTATTTGTCCCTCATTCTCAACTTAATCTACATCCTTTATTGCTGGTATGTATTGCAGATTTGGGTTCAGCCAGAGTGCCCGAAACTGTTGGCG
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 87.50% | 7.40% | 5.08% | 0.00% | NA |
All Indica | 2759 | 96.80% | 2.90% | 0.33% | 0.00% | NA |
All Japonica | 1512 | 69.40% | 16.00% | 14.55% | 0.00% | NA |
Aus | 269 | 90.70% | 6.70% | 2.60% | 0.00% | NA |
Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 97.00% | 2.40% | 0.65% | 0.00% | NA |
Indica III | 913 | 95.20% | 4.60% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 97.20% | 2.30% | 0.51% | 0.00% | NA |
Temperate Japonica | 767 | 71.20% | 10.80% | 17.99% | 0.00% | NA |
Tropical Japonica | 504 | 68.10% | 22.80% | 9.13% | 0.00% | NA |
Japonica Intermediate | 241 | 66.80% | 18.30% | 14.94% | 0.00% | NA |
VI/Aromatic | 96 | 94.80% | 4.20% | 1.04% | 0.00% | NA |
Intermediate | 90 | 88.90% | 7.80% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0235431697 | A -> T | LOC_Os02g57850.1 | upstream_gene_variant ; 4356.0bp to feature; MODIFIER | silent_mutation | Average:79.802; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | N | N | N | N |
vg0235431697 | A -> T | LOC_Os02g57854.1 | downstream_gene_variant ; 1057.0bp to feature; MODIFIER | silent_mutation | Average:79.802; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | N | N | N | N |
vg0235431697 | A -> T | LOC_Os02g57870.1 | downstream_gene_variant ; 1965.0bp to feature; MODIFIER | silent_mutation | Average:79.802; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | N | N | N | N |
vg0235431697 | A -> T | LOC_Os02g57854.2 | downstream_gene_variant ; 1057.0bp to feature; MODIFIER | silent_mutation | Average:79.802; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | N | N | N | N |
vg0235431697 | A -> T | LOC_Os02g57870.2 | downstream_gene_variant ; 1898.0bp to feature; MODIFIER | silent_mutation | Average:79.802; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | N | N | N | N |
vg0235431697 | A -> T | LOC_Os02g57860.1 | intron_variant ; MODIFIER | silent_mutation | Average:79.802; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0235431697 | NA | 8.35E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0235431697 | NA | 4.89E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0235431697 | NA | 1.70E-06 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0235431697 | NA | 3.11E-11 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0235431697 | 5.19E-07 | 1.44E-21 | mr1968_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |