Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235268833:

Variant ID: vg0235268833 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35268833
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATGGTACATGATGGTGCTCGTCGTCCTCACCGGTCACCTCGACGACGCCGAGATCGCCGTCGACTCCATATCTATATGGTACTCCCTCCTTCCCTAGAT[A/G]
TTTAACACTGTTAACTTTTTAAAAAATGTTTGACCGTTCGTTTTATTTAAAAACTTTTGTGATATGTGTAAAACAATATGTATACATAAAAGTATATTTA

Reverse complement sequence

TAAATATACTTTTATGTATACATATTGTTTTACACATATCACAAAAGTTTTTAAATAAAACGAACGGTCAAACATTTTTTAAAAAGTTAACAGTGTTAAA[T/C]
ATCTAGGGAAGGAGGGAGTACCATATAGATATGGAGTCGACGGCGATCTCGGCGTCGTCGAGGTGACCGGTGAGGACGACGAGCACCATCATGTACCATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.90%	41.60%	0.42%	0.00%	NA
All Indica	2759	44.90%	54.50%	0.65%	0.00%	NA
All Japonica	1512	91.10%	8.90%	0.00%	0.00%	NA
Aus	269	21.60%	78.40%	0.00%	0.00%	NA
Indica I	595	24.70%	73.90%	1.34%	0.00%	NA
Indica II	465	66.20%	33.10%	0.65%	0.00%	NA
Indica III	913	46.50%	53.30%	0.11%	0.00%	NA
Indica Intermediate	786	45.50%	53.70%	0.76%	0.00%	NA
Temperate Japonica	767	95.70%	4.30%	0.00%	0.00%	NA
Tropical Japonica	504	95.40%	4.60%	0.00%	0.00%	NA
Japonica Intermediate	241	67.20%	32.80%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	61.10%	36.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235268833	A -> G	LOC_Os02g57560.1	upstream_gene_variant ; 3440.0bp to feature; MODIFIER	silent_mutation	Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235268833	A -> G	LOC_Os02g57580.1	upstream_gene_variant ; 385.0bp to feature; MODIFIER	silent_mutation	Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235268833	A -> G	LOC_Os02g57590.1	upstream_gene_variant ; 2754.0bp to feature; MODIFIER	silent_mutation	Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235268833	A -> G	LOC_Os02g57590.2	upstream_gene_variant ; 2754.0bp to feature; MODIFIER	silent_mutation	Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235268833	A -> G	LOC_Os02g57570.1	downstream_gene_variant ; 3.0bp to feature; MODIFIER	silent_mutation	Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235268833	A -> G	LOC_Os02g57570-LOC_Os02g57580	intergenic_region ; MODIFIER	silent_mutation	Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235268833	NA	2.69E-53	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0235268833	NA	1.94E-42	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	3.58E-08	1.31E-12	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	5.10E-06	4.10E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	2.18E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	5.52E-37	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	2.40E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	9.87E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	2.94E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	3.29E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	3.67E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	2.24E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	1.07E-11	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	1.77E-07	1.59E-65	mr1125_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	5.23E-06	1.38E-09	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	7.38E-06	5.59E-12	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	3.89E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	6.72E-37	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	2.43E-24	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833	NA	5.27E-58	mr1695_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251