\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235268833:

Variant ID: vg0235268833 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35268833
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGGTACATGATGGTGCTCGTCGTCCTCACCGGTCACCTCGACGACGCCGAGATCGCCGTCGACTCCATATCTATATGGTACTCCCTCCTTCCCTAGAT[A/G]
TTTAACACTGTTAACTTTTTAAAAAATGTTTGACCGTTCGTTTTATTTAAAAACTTTTGTGATATGTGTAAAACAATATGTATACATAAAAGTATATTTA

Reverse complement sequence

TAAATATACTTTTATGTATACATATTGTTTTACACATATCACAAAAGTTTTTAAATAAAACGAACGGTCAAACATTTTTTAAAAAGTTAACAGTGTTAAA[T/C]
ATCTAGGGAAGGAGGGAGTACCATATAGATATGGAGTCGACGGCGATCTCGGCGTCGTCGAGGTGACCGGTGAGGACGACGAGCACCATCATGTACCATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 41.60% 0.42% 0.00% NA
All Indica  2759 44.90% 54.50% 0.65% 0.00% NA
All Japonica  1512 91.10% 8.90% 0.00% 0.00% NA
Aus  269 21.60% 78.40% 0.00% 0.00% NA
Indica I  595 24.70% 73.90% 1.34% 0.00% NA
Indica II  465 66.20% 33.10% 0.65% 0.00% NA
Indica III  913 46.50% 53.30% 0.11% 0.00% NA
Indica Intermediate  786 45.50% 53.70% 0.76% 0.00% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 95.40% 4.60% 0.00% 0.00% NA
Japonica Intermediate  241 67.20% 32.80% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 61.10% 36.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235268833 A -> G LOC_Os02g57560.1 upstream_gene_variant ; 3440.0bp to feature; MODIFIER silent_mutation Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0235268833 A -> G LOC_Os02g57580.1 upstream_gene_variant ; 385.0bp to feature; MODIFIER silent_mutation Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0235268833 A -> G LOC_Os02g57590.1 upstream_gene_variant ; 2754.0bp to feature; MODIFIER silent_mutation Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0235268833 A -> G LOC_Os02g57590.2 upstream_gene_variant ; 2754.0bp to feature; MODIFIER silent_mutation Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0235268833 A -> G LOC_Os02g57570.1 downstream_gene_variant ; 3.0bp to feature; MODIFIER silent_mutation Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0235268833 A -> G LOC_Os02g57570-LOC_Os02g57580 intergenic_region ; MODIFIER silent_mutation Average:73.738; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235268833 NA 2.69E-53 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0235268833 NA 1.94E-42 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 3.58E-08 1.31E-12 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 5.10E-06 4.10E-07 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 2.18E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 5.52E-37 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 2.40E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 9.87E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 2.94E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 3.29E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 3.67E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 2.24E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 1.07E-11 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 1.77E-07 1.59E-65 mr1125_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 5.23E-06 1.38E-09 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 7.38E-06 5.59E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 3.89E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 6.72E-37 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 2.43E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235268833 NA 5.27E-58 mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251