\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235249589:

Variant ID: vg0235249589 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35249589
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCTAATCTAGTACGGGATGCAACGAATCCTAATCCCTCCGTTTTATTTCAAGTGCAGTTATAATTTTCTGTGCCTAACTTTAATTGTCCGTCTTATTT[A/G]
AAAATTTTTTAAAAAAATTAAAAACATAAGTCATGCATAAACCTTCTTATTTGCTACATAGAGCTACTGTACCCGCCTATTGGCACCAACCAGCTACTGT

Reverse complement sequence

ACAGTAGCTGGTTGGTGCCAATAGGCGGGTACAGTAGCTCTATGTAGCAAATAAGAAGGTTTATGCATGACTTATGTTTTTAATTTTTTTAAAAAATTTT[T/C]
AAATAAGACGGACAATTAAAGTTAGGCACAGAAAATTATAACTGCACTTGAAATAAAACGGAGGGATTAGGATTCGTTGCATCCCGTACTAGATTAGCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.10% 18.90% 10.81% 32.23% NA
All Indica  2759 12.00% 21.70% 16.53% 49.73% NA
All Japonica  1512 75.30% 15.20% 0.99% 8.47% NA
Aus  269 73.60% 14.10% 12.27% 0.00% NA
Indica I  595 17.50% 9.20% 34.96% 38.32% NA
Indica II  465 9.90% 7.30% 9.25% 73.55% NA
Indica III  913 6.00% 39.20% 11.28% 43.48% NA
Indica Intermediate  786 16.20% 19.30% 12.98% 51.53% NA
Temperate Japonica  767 92.00% 1.40% 0.65% 5.87% NA
Tropical Japonica  504 55.20% 40.30% 0.99% 3.57% NA
Japonica Intermediate  241 64.30% 6.60% 2.07% 26.97% NA
VI/Aromatic  96 89.60% 6.20% 2.08% 2.08% NA
Intermediate  90 50.00% 21.10% 5.56% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235249589 A -> G LOC_Os02g57530.1 upstream_gene_variant ; 1804.0bp to feature; MODIFIER silent_mutation Average:89.946; most accessible tissue: Minghui63 flag leaf, score: 95.135 N N N N
vg0235249589 A -> G LOC_Os02g57530.2 upstream_gene_variant ; 1804.0bp to feature; MODIFIER silent_mutation Average:89.946; most accessible tissue: Minghui63 flag leaf, score: 95.135 N N N N
vg0235249589 A -> G LOC_Os02g57530.3 upstream_gene_variant ; 1804.0bp to feature; MODIFIER silent_mutation Average:89.946; most accessible tissue: Minghui63 flag leaf, score: 95.135 N N N N
vg0235249589 A -> G LOC_Os02g57530.4 upstream_gene_variant ; 1804.0bp to feature; MODIFIER silent_mutation Average:89.946; most accessible tissue: Minghui63 flag leaf, score: 95.135 N N N N
vg0235249589 A -> G LOC_Os02g57520-LOC_Os02g57530 intergenic_region ; MODIFIER silent_mutation Average:89.946; most accessible tissue: Minghui63 flag leaf, score: 95.135 N N N N
vg0235249589 A -> DEL N N silent_mutation Average:89.946; most accessible tissue: Minghui63 flag leaf, score: 95.135 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0235249589 A G -0.04 -0.04 -0.01 -0.07 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235249589 NA 9.64E-09 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 3.53E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 1.21E-08 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 1.06E-06 NA mr1088 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 1.23E-08 1.26E-11 mr1088 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 7.31E-09 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 1.50E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 2.56E-06 NA mr1103 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 9.39E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 7.06E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 2.82E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 3.43E-11 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 1.62E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 3.52E-06 8.61E-12 mr1213 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 1.43E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 3.70E-07 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 6.79E-07 9.15E-10 mr1246 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 3.66E-06 1.83E-08 mr1404 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 4.30E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 1.40E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 3.10E-06 1.07E-08 mr1620 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 6.65E-07 9.37E-08 mr1878 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 5.41E-08 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 2.33E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 4.92E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 8.54E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235249589 NA 3.64E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251