Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235121354:

Variant ID: vg0235121354 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35121354
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

AAACTTACAACATCAGTTCCAATGATGTAATCGAATGGAGGATCAACAGCTCTTATATGATCTTTGTTACCCCAGTCCAATTCTGCAACGGTGACAGAGC[C/T]
GATGGAGCCTGTTTGCCACGTAAAATCAATTGTTAGGAGAACTAGCAACGTCCAATTGTTATGAGAAACTTCCACAAACTTAACTAACCACTAGGCACCA

Reverse complement sequence

TGGTGCCTAGTGGTTAGTTAAGTTTGTGGAAGTTTCTCATAACAATTGGACGTTGCTAGTTCTCCTAACAATTGATTTTACGTGGCAAACAGGCTCCATC[G/A]
GCTCTGTCACCGTTGCAGAATTGGACTGGGGTAACAAAGATCATATAAGAGCTGTTGATCCTCCATTCGATTACATCATTGGAACTGATGTTGTAAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	41.70%	0.15%	0.00%	NA
All Indica	2759	44.70%	55.10%	0.14%	0.00%	NA
All Japonica	1512	78.70%	21.20%	0.13%	0.00%	NA
Aus	269	68.00%	32.00%	0.00%	0.00%	NA
Indica I	595	4.20%	95.60%	0.17%	0.00%	NA
Indica II	465	77.80%	22.20%	0.00%	0.00%	NA
Indica III	913	48.10%	51.80%	0.11%	0.00%	NA
Indica Intermediate	786	51.90%	47.80%	0.25%	0.00%	NA
Temperate Japonica	767	97.40%	2.60%	0.00%	0.00%	NA
Tropical Japonica	504	59.50%	40.30%	0.20%	0.00%	NA
Japonica Intermediate	241	59.30%	40.20%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	57.80%	41.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235121354	C -> T	LOC_Os02g57330.1	missense_variant ; p.Gly123Ser; MODERATE	nonsynonymous_codon ; G123S	Average:46.458; most accessible tissue: Callus, score: 63.648	probably damaging	2.2	DELETERIOUS	0.04
vg0235121354	C -> T	LOC_Os02g57330.2	missense_variant ; p.Gly42Ser; MODERATE	nonsynonymous_codon ; G42S	Average:46.458; most accessible tissue: Callus, score: 63.648	possibly damaging	1.975	DELETERIOUS	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235121354	NA	1.45E-11	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0235121354	NA	1.79E-08	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	6.17E-06	mr1232	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	2.76E-12	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	4.22E-09	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	2.05E-10	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	5.39E-07	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	1.19E-10	mr1715	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	1.05E-07	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	1.30E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	2.10E-07	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	4.15E-08	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	2.15E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	8.36E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	1.47E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	2.08E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	5.30E-10	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	5.67E-10	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	4.99E-13	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	1.95E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	1.06E-14	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	8.11E-08	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	6.48E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	1.05E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	8.61E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	6.62E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235121354	NA	2.14E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251