Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0235055826:

Variant ID: vg0235055826 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35055826
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TGCATTGACTGGAGAGAAGTTAGCAACTTACTATCTTCGTTAAAAAAATATAAGGAATTATAGCTAGAATCAATCTCTTATACTCCCTCCTTCCCTAAAT[G/A]
TTTGATGCCGTTGACTTTTTTAAACAAGTTTGACCGTTCGTCTTATTCAAAAACTTTTATGAAATATGTAAAACTATATGTATGTATAAAAGTATATTTA

Reverse complement sequence

TAAATATACTTTTATACATACATATAGTTTTACATATTTCATAAAAGTTTTTGAATAAGACGAACGGTCAAACTTGTTTAAAAAAGTCAACGGCATCAAA[C/T]
ATTTAGGGAAGGAGGGAGTATAAGAGATTGATTCTAGCTATAATTCCTTATATTTTTTTAACGAAGATAGTAAGTTGCTAACTTCTCTCCAGTCAATGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.60%	44.30%	0.08%	0.00%	NA
All Indica	2759	42.10%	57.90%	0.04%	0.00%	NA
All Japonica	1512	86.40%	13.40%	0.13%	0.00%	NA
Aus	269	33.80%	66.20%	0.00%	0.00%	NA
Indica I	595	7.20%	92.80%	0.00%	0.00%	NA
Indica II	465	79.10%	20.90%	0.00%	0.00%	NA
Indica III	913	44.10%	55.80%	0.11%	0.00%	NA
Indica Intermediate	786	44.10%	55.90%	0.00%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	65.70%	34.10%	0.20%	0.00%	NA
Japonica Intermediate	241	91.70%	7.90%	0.41%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	61.10%	37.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235055826	G -> A	LOC_Os02g57210.1	downstream_gene_variant ; 1483.0bp to feature; MODIFIER	silent_mutation	Average:38.038; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg0235055826	G -> A	LOC_Os02g57220.1	downstream_gene_variant ; 1104.0bp to feature; MODIFIER	silent_mutation	Average:38.038; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg0235055826	G -> A	LOC_Os02g57210-LOC_Os02g57220	intergenic_region ; MODIFIER	silent_mutation	Average:38.038; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235055826	NA	5.24E-07	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	1.91E-10	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	5.86E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	5.16E-07	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	2.11E-08	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	6.55E-11	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	1.00E-16	mr1598_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	2.77E-11	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	1.45E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	4.29E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	7.40E-06	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	2.35E-07	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	4.07E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235055826	NA	4.35E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251