\
| Variant ID: vg0235055826 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35055826 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 117. )
TGCATTGACTGGAGAGAAGTTAGCAACTTACTATCTTCGTTAAAAAAATATAAGGAATTATAGCTAGAATCAATCTCTTATACTCCCTCCTTCCCTAAAT[G/A]
TTTGATGCCGTTGACTTTTTTAAACAAGTTTGACCGTTCGTCTTATTCAAAAACTTTTATGAAATATGTAAAACTATATGTATGTATAAAAGTATATTTA
TAAATATACTTTTATACATACATATAGTTTTACATATTTCATAAAAGTTTTTGAATAAGACGAACGGTCAAACTTGTTTAAAAAAGTCAACGGCATCAAA[C/T]
ATTTAGGGAAGGAGGGAGTATAAGAGATTGATTCTAGCTATAATTCCTTATATTTTTTTAACGAAGATAGTAAGTTGCTAACTTCTCTCCAGTCAATGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.60% | 44.30% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 42.10% | 57.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 86.40% | 13.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 33.80% | 66.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 7.20% | 92.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 79.10% | 20.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 44.10% | 55.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 44.10% | 55.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.70% | 34.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.70% | 7.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 37.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235055826 | G -> A | LOC_Os02g57210.1 | downstream_gene_variant ; 1483.0bp to feature; MODIFIER | silent_mutation | Average:38.038; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| vg0235055826 | G -> A | LOC_Os02g57220.1 | downstream_gene_variant ; 1104.0bp to feature; MODIFIER | silent_mutation | Average:38.038; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| vg0235055826 | G -> A | LOC_Os02g57210-LOC_Os02g57220 | intergenic_region ; MODIFIER | silent_mutation | Average:38.038; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235055826 | NA | 5.24E-07 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 1.91E-10 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 5.86E-07 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 5.16E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 2.11E-08 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 6.55E-11 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 1.00E-16 | mr1598_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 2.77E-11 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 1.45E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 4.29E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 7.40E-06 | mr1931_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 2.35E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 4.07E-06 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235055826 | NA | 4.35E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |