Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0234169418:

Variant ID: vg0234169418 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34169418
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCGAGACAGGTGCACGCGTACAGTCATTCCATGGATCGCATACAATAGCTACTAAATCACATTAGTTGTTGCAAAGCCATGACAATAAAAGATAGAGA[G/T]
GATGTTCTCCCAATGACCTGTAGGGTGAAACGGAGCATGAGACAACAAGTTCTTCCACGTATATAATTTTTTTGGGGTCTTTAAATTTTCGTTCGTTATA

Reverse complement sequence

TATAACGAACGAAAATTTAAAGACCCCAAAAAAATTATATACGTGGAAGAACTTGTTGTCTCATGCTCCGTTTCACCCTACAGGTCATTGGGAGAACATC[C/A]
TCTCTATCTTTTATTGTCATGGCTTTGCAACAACTAATGTGATTTAGTAGCTATTGTATGCGATCCATGGAATGACTGTACGCGTGCACCTGTCTCGACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.40%	4.90%	4.95%	34.77%	NA
All Indica	2759	35.00%	0.00%	6.27%	58.72%	NA
All Japonica	1512	80.80%	15.10%	3.64%	0.46%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	21.80%	0.00%	5.71%	72.44%	NA
Indica II	465	47.70%	0.00%	6.02%	46.24%	NA
Indica III	913	31.20%	0.00%	7.45%	61.34%	NA
Indica Intermediate	786	41.90%	0.00%	5.47%	52.67%	NA
Temperate Japonica	767	83.60%	11.20%	4.82%	0.39%	NA
Tropical Japonica	504	92.10%	5.80%	1.59%	0.60%	NA
Japonica Intermediate	241	48.50%	46.90%	4.15%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	74.40%	2.20%	5.56%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234169418	G -> T	LOC_Os02g55800.1	upstream_gene_variant ; 3065.0bp to feature; MODIFIER	silent_mutation	Average:13.899; most accessible tissue: Minghui63 flower, score: 21.166	N	N	N	N
vg0234169418	G -> T	LOC_Os02g55810.1	downstream_gene_variant ; 1050.0bp to feature; MODIFIER	silent_mutation	Average:13.899; most accessible tissue: Minghui63 flower, score: 21.166	N	N	N	N
vg0234169418	G -> T	LOC_Os02g55820.1	downstream_gene_variant ; 2692.0bp to feature; MODIFIER	silent_mutation	Average:13.899; most accessible tissue: Minghui63 flower, score: 21.166	N	N	N	N
vg0234169418	G -> T	LOC_Os02g55810-LOC_Os02g55820	intergenic_region ; MODIFIER	silent_mutation	Average:13.899; most accessible tissue: Minghui63 flower, score: 21.166	N	N	N	N
vg0234169418	G -> DEL	N	N	silent_mutation	Average:13.899; most accessible tissue: Minghui63 flower, score: 21.166	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234169418	NA	5.17E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234169418	NA	1.63E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234169418	NA	3.27E-08	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234169418	NA	8.36E-07	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234169418	NA	6.72E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234169418	8.92E-06	1.04E-08	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234169418	1.72E-07	6.00E-10	mr1613_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234169418	7.63E-07	4.69E-08	mr1619_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234169418	1.53E-06	2.03E-07	mr1795_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234169418	1.42E-06	3.18E-08	mr1913_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251