\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233789179:

Variant ID: vg0233789179 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 33789179
Reference Allele: TAAAlternative Allele: AAA,TA,T,TAAAA,TAAA
Primary Allele: TAASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTGACAATTGTTAAATGCTCGAATTTTGTTTTAACCAACATTTTCTATGATATGAAAAAAATGATTTATTGGAAAAAATAGAACAAGATTTTTTTTTT[TAA/AAA,TA,T,TAAAA,TAAA]
AAAAAAGAGAAACCATGTGCACTGTATTTCTTCATGTTGGAAGATCAATTTGCAAAAATCATATCGTAAACATATCAATCTTAGAACATACTTAATTACT

Reverse complement sequence

AGTAATTAAGTATGTTCTAAGATTGATATGTTTACGATATGATTTTTGCAAATTGATCTTCCAACATGAAGAAATACAGTGCACATGGTTTCTCTTTTTT[TTA/TTT,TA,A,TTTTA,TTTA]
AAAAAAAAAATCTTGTTCTATTTTTTCCAATAAATCATTTTTTTCATATCATAGAAAATGTTGGTTAAAACAAAATTCGAGCATTTAACAATTGTCACGG

Allele Frequencies:

Populations Population SizeFrequency of TAA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 19.60% 7.36% 0.66% AAA: 15.00%; T: 0.08%; TAAAA: 0.06%; TAAA: 0.04%
All Indica  2759 65.70% 30.20% 2.50% 0.69% AAA: 0.76%; T: 0.14%; TAAA: 0.04%
All Japonica  1512 46.30% 0.30% 14.62% 0.20% AAA: 38.36%; TAAAA: 0.20%
Aus  269 39.00% 26.00% 12.27% 2.23% AAA: 20.07%; TAAA: 0.37%
Indica I  595 85.50% 12.10% 1.85% 0.00% T: 0.50%
Indica II  465 77.80% 20.40% 1.51% 0.00% AAA: 0.22%
Indica III  913 49.40% 47.80% 1.20% 0.44% AAA: 1.10%; T: 0.11%
Indica Intermediate  786 62.50% 29.10% 5.09% 1.91% AAA: 1.27%; TAAA: 0.13%
Temperate Japonica  767 47.50% 0.30% 22.16% 0.13% AAA: 29.99%
Tropical Japonica  504 54.20% 0.00% 4.76% 0.00% AAA: 40.48%; TAAAA: 0.60%
Japonica Intermediate  241 26.10% 1.20% 11.20% 0.83% AAA: 60.58%
VI/Aromatic  96 34.40% 12.50% 10.42% 0.00% AAA: 42.71%
Intermediate  90 55.60% 10.00% 16.67% 3.33% AAA: 14.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233789179 TAA -> TA LOC_Os02g55160.1 upstream_gene_variant ; 2005.0bp to feature; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TA LOC_Os02g55170.1 downstream_gene_variant ; 3953.0bp to feature; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TA LOC_Os02g55150.1 intron_variant ; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TA LOC_Os02g55150.2 intron_variant ; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> DEL N N silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TAAAA LOC_Os02g55160.1 upstream_gene_variant ; 2004.0bp to feature; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TAAAA LOC_Os02g55170.1 downstream_gene_variant ; 3952.0bp to feature; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TAAAA LOC_Os02g55150.1 intron_variant ; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TAAAA LOC_Os02g55150.2 intron_variant ; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> AAA LOC_Os02g55160.1 upstream_gene_variant ; 2007.0bp to feature; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> AAA LOC_Os02g55170.1 downstream_gene_variant ; 3955.0bp to feature; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> AAA LOC_Os02g55150.1 intron_variant ; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> AAA LOC_Os02g55150.2 intron_variant ; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TAAA LOC_Os02g55160.1 upstream_gene_variant ; 2004.0bp to feature; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TAAA LOC_Os02g55170.1 downstream_gene_variant ; 3952.0bp to feature; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TAAA LOC_Os02g55150.1 intron_variant ; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> TAAA LOC_Os02g55150.2 intron_variant ; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> T LOC_Os02g55160.1 upstream_gene_variant ; 2006.0bp to feature; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> T LOC_Os02g55170.1 downstream_gene_variant ; 3954.0bp to feature; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> T LOC_Os02g55150.1 intron_variant ; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N
vg0233789179 TAA -> T LOC_Os02g55150.2 intron_variant ; MODIFIER silent_mutation Average:36.704; most accessible tissue: Callus, score: 71.124 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233789179 3.80E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233789179 1.65E-07 NA mr1079 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233789179 5.37E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233789179 1.29E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233789179 4.71E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251