Variant ID: vg0232442595 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 32442595 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACGCTATACCACGTTGCAACAGGCCCAACCATCCACCTATACTATTCAATTCCAAAAGACTAGTCTAGGGTGAGTCTAATCACGGTGAATCTGGTTGAC[C/T]
GCCCATAACCGCGGGCACGGCTATTCGAATAGTTTTACTCCGATCAGAGGTGTACAACTGTACCAACAAGACACAGCCCCACGACATGTTTCCATGCGCC
GGCGCATGGAAACATGTCGTGGGGCTGTGTCTTGTTGGTACAGTTGTACACCTCTGATCGGAGTAAAACTATTCGAATAGCCGTGCCCGCGGTTATGGGC[G/A]
GTCAACCAGATTCACCGTGATTAGACTCACCCTAGACTAGTCTTTTGGAATTGAATAGTATAGGTGGATGGTTGGGCCTGTTGCAACGTGGTATAGCGTT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 52.70% | 0.20% | 6.88% | 40.18% | NA |
All Indica | 2759 | 29.20% | 0.20% | 8.48% | 62.05% | NA |
All Japonica | 1512 | 99.10% | 0.00% | 0.26% | 0.66% | NA |
Aus | 269 | 35.70% | 1.90% | 20.07% | 42.38% | NA |
Indica I | 595 | 21.50% | 0.00% | 5.04% | 73.45% | NA |
Indica II | 465 | 27.70% | 0.40% | 8.82% | 63.01% | NA |
Indica III | 913 | 37.30% | 0.20% | 10.08% | 52.35% | NA |
Indica Intermediate | 786 | 26.60% | 0.30% | 9.03% | 64.12% | NA |
Temperate Japonica | 767 | 99.50% | 0.00% | 0.13% | 0.39% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 95.90% | 0.00% | 1.24% | 2.90% | NA |
VI/Aromatic | 96 | 29.20% | 0.00% | 31.25% | 39.58% | NA |
Intermediate | 90 | 68.90% | 0.00% | 3.33% | 27.78% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0232442595 | C -> T | LOC_Os02g53010.1 | downstream_gene_variant ; 267.0bp to feature; MODIFIER | silent_mutation | Average:9.928; most accessible tissue: Callus, score: 22.161 | N | N | N | N |
vg0232442595 | C -> T | LOC_Os02g53010-LOC_Os02g53020 | intergenic_region ; MODIFIER | silent_mutation | Average:9.928; most accessible tissue: Callus, score: 22.161 | N | N | N | N |
vg0232442595 | C -> DEL | N | N | silent_mutation | Average:9.928; most accessible tissue: Callus, score: 22.161 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0232442595 | 3.96E-06 | NA | mr1044 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0232442595 | NA | 5.26E-08 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0232442595 | NA | 7.80E-06 | mr1948 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |