Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0231596229:

Variant ID: vg0231596229 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 31596229
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ACGGTTAAGCGCTAATTGCAGGGTTAAGCGTTTTTCGATTTGGCGACGGTTAAGCGCTAATTGGGAGGGTTAAGCGCTAATTGTAACTAAACAACTTGTG[C/T]
TTTTTATATTAGTGTAAACAACTTGTGCTTTTTATATTAGTGTAGATGAAGTCGGCTTGGGAATTTCAAATTTCCAATTGCACAATTGCACTGCCTTCTC

Reverse complement sequence

GAGAAGGCAGTGCAATTGTGCAATTGGAAATTTGAAATTCCCAAGCCGACTTCATCTACACTAATATAAAAAGCACAAGTTGTTTACACTAATATAAAAA[G/A]
CACAAGTTGTTTAGTTACAATTAGCGCTTAACCCTCCCAATTAGCGCTTAACCGTCGCCAAATCGAAAAACGCTTAACCCTGCAATTAGCGCTTAACCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	41.10%	0.08%	0.00%	NA
All Indica	2759	31.00%	68.90%	0.11%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	2.40%	97.50%	0.17%	0.00%	NA
Indica II	465	51.20%	48.60%	0.22%	0.00%	NA
Indica III	913	31.70%	68.30%	0.00%	0.00%	NA
Indica Intermediate	786	39.80%	60.10%	0.13%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0231596229	C -> T	LOC_Os02g51580.1	upstream_gene_variant ; 1103.0bp to feature; MODIFIER	silent_mutation	Average:60.933; most accessible tissue: Callus, score: 88.732	N	N	N	N
vg0231596229	C -> T	LOC_Os02g51590.1	upstream_gene_variant ; 1395.0bp to feature; MODIFIER	silent_mutation	Average:60.933; most accessible tissue: Callus, score: 88.732	N	N	N	N
vg0231596229	C -> T	LOC_Os02g51570.1	downstream_gene_variant ; 3077.0bp to feature; MODIFIER	silent_mutation	Average:60.933; most accessible tissue: Callus, score: 88.732	N	N	N	N
vg0231596229	C -> T	LOC_Os02g51580-LOC_Os02g51590	intergenic_region ; MODIFIER	silent_mutation	Average:60.933; most accessible tissue: Callus, score: 88.732	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0231596229	NA	4.72E-12	Grain_thickness	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0231596229	NA	2.30E-06	Grain_weight	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0231596229	NA	4.56E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	7.60E-23	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	3.58E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	3.88E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	1.43E-08	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	1.83E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	2.36E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	5.33E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	2.83E-08	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	5.05E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	1.66E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	8.69E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	6.79E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	4.54E-19	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	8.67E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	2.27E-14	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	1.08E-06	mr1717_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	9.28E-08	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	8.99E-14	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	2.11E-08	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	3.14E-07	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	3.95E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231596229	NA	3.95E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251