\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230660705:

Variant ID: vg0230660705 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30660705
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTGAAGCGAAATGGATGGTAATTCCCATACTTAATCTGGTATAATTCTAGAATTTTCTTCATCGTAACATAAAATTTGGTTTCTAATTGGTACTTCCT[C/T]
TGTTTCATAATGTAAATCATTCTAACATTTCTCCATTCATATTGATGTTAATGAATCTAAATATATATATCTATCTATATTCATTAACATCAATATAAAT

Reverse complement sequence

ATTTATATTGATGTTAATGAATATAGATAGATATATATATTTAGATTCATTAACATCAATATGAATGGAGAAATGTTAGAATGATTTACATTATGAAACA[G/A]
AGGAAGTACCAATTAGAAACCAAATTTTATGTTACGATGAAGAAAATTCTAGAATTATACCAGATTAAGTATGGGAATTACCATCCATTTCGCTTCAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 7.70% 13.99% 8.10% NA
All Indica  2759 56.10% 7.60% 22.87% 13.37% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.07% NA
Aus  269 33.10% 55.00% 8.18% 3.72% NA
Indica I  595 44.40% 3.20% 38.82% 13.61% NA
Indica II  465 59.10% 10.30% 17.85% 12.69% NA
Indica III  913 63.60% 5.90% 14.35% 16.10% NA
Indica Intermediate  786 54.60% 11.30% 23.66% 10.43% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 84.40% 5.60% 6.67% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230660705 C -> T LOC_Os02g50220.1 upstream_gene_variant ; 611.0bp to feature; MODIFIER silent_mutation Average:66.953; most accessible tissue: Callus, score: 94.522 N N N N
vg0230660705 C -> T LOC_Os02g50200.1 downstream_gene_variant ; 4253.0bp to feature; MODIFIER silent_mutation Average:66.953; most accessible tissue: Callus, score: 94.522 N N N N
vg0230660705 C -> T LOC_Os02g50210.1 downstream_gene_variant ; 1354.0bp to feature; MODIFIER silent_mutation Average:66.953; most accessible tissue: Callus, score: 94.522 N N N N
vg0230660705 C -> T LOC_Os02g50210-LOC_Os02g50220 intergenic_region ; MODIFIER silent_mutation Average:66.953; most accessible tissue: Callus, score: 94.522 N N N N
vg0230660705 C -> DEL N N silent_mutation Average:66.953; most accessible tissue: Callus, score: 94.522 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0230660705 C T -0.01 -0.01 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230660705 NA 2.92E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230660705 NA 5.06E-06 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230660705 NA 9.81E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230660705 NA 3.78E-09 mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230660705 NA 5.53E-08 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230660705 NA 2.43E-10 mr1241_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230660705 NA 2.59E-07 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230660705 NA 5.21E-09 mr1437_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230660705 NA 2.01E-08 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251