Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230183930:

Variant ID: vg0230183930 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 30183930
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTACGAGTTTTTTTCATCTCATGTAGATGGATCGGCAATGGATGTACGCTGACCGGCGGTCCAAAGAGTTTATTGATGGCGTGCATTATTTTTTGAGA[A/G]
TGGCCGAAGCTAATAGGTATAAGGGTTTTATTTGTTGTCCATGCAATAAGTGTAAGAATCAGAAGGGGTATTCTGCATCCAGGACTATTCATTTCCACTT

Reverse complement sequence

AAGTGGAAATGAATAGTCCTGGATGCAGAATACCCCTTCTGATTCTTACACTTATTGCATGGACAACAAATAAAACCCTTATACCTATTAGCTTCGGCCA[T/C]
TCTCAAAAAATAATGCACGCCATCAATAAACTCTTTGGACCGCCGGTCAGCGTACATCCATTGCCGATCCATCTACATGAGATGAAAAAAACTCGTACAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.90%	2.30%	56.47%	3.39%	NA
All Indica	2759	3.70%	3.60%	87.02%	5.65%	NA
All Japonica	1512	99.30%	0.00%	0.66%	0.07%	NA
Aus	269	11.50%	3.30%	85.13%	0.00%	NA
Indica I	595	2.50%	3.00%	81.01%	13.45%	NA
Indica II	465	6.00%	3.40%	85.81%	4.73%	NA
Indica III	913	2.30%	3.80%	92.22%	1.64%	NA
Indica Intermediate	786	5.00%	3.80%	86.26%	4.96%	NA
Temperate Japonica	767	99.60%	0.00%	0.26%	0.13%	NA
Tropical Japonica	504	99.00%	0.00%	0.99%	0.00%	NA
Japonica Intermediate	241	98.80%	0.00%	1.24%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	65.60%	0.00%	31.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230183930	A -> G	LOC_Os02g49400.1	start_lost ; p.Met1?; HIGH	nonsynonymous_codon ; M1V	Average:12.744; most accessible tissue: Zhenshan97 young leaf, score: 17.571	unknown	unknown	TOLERATED	1.00
vg0230183930	A -> DEL	LOC_Os02g49400.1	N	frameshift_variant	Average:12.744; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230183930	NA	1.13E-25	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	3.46E-09	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	9.72E-06	NA	mr1053	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	1.00E-11	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	5.30E-11	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	5.90E-27	mr1148	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	4.07E-16	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	1.08E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	1.44E-27	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	8.57E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	4.61E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	2.38E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	2.29E-13	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	1.99E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	1.31E-28	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	5.69E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	8.53E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	7.29E-24	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	7.69E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	8.01E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	1.98E-26	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	3.10E-28	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	5.91E-25	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	5.46E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	2.61E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	2.44E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	2.73E-19	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230183930	NA	4.50E-24	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251