\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230107152:

Variant ID: vg0230107152 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 30107152
Reference Allele: ATAlternative Allele: TT,ATT,A
Primary Allele: ATSecondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAATTTTGCTGTTGCTGTTGGTATCATCATGGCAAACAAAATGGTAGTAATATTTTTTTTTAAAAAAAAAGTGTACAGTTTTTTGTATACTCGTGCAA[AT/TT,ATT,A]
TTTTTTTTTTGGTCTACAAGGAAACATGATTGTTCACACACAGGATCTACTGTCTTTGTAGGTGATGGGGAGTGTTGGGTTTAAGTTCCCAATTGCACTA

Reverse complement sequence

TAGTGCAATTGGGAACTTAAACCCAACACTCCCCATCACCTACAAAGACAGTAGATCCTGTGTGTGAACAATCATGTTTCCTTGTAGACCAAAAAAAAAA[AT/AA,AAT,T]
TTGCACGAGTATACAAAAAACTGTACACTTTTTTTTTAAAAAAAAATATTACTACCATTTTGTTTGCCATGATGATACCAACAGCAACAGCAAAATTAAA

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of TT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.70% 8.80% 3.77% 46.17% ATT: 0.55%; A: 0.02%
All Indica  2759 6.20% 13.50% 4.10% 76.26% NA
All Japonica  1512 97.20% 0.00% 0.73% 0.33% ATT: 1.72%; A: 0.07%
Aus  269 49.40% 15.20% 17.84% 17.47% NA
Indica I  595 4.20% 7.60% 6.72% 81.51% NA
Indica II  465 6.50% 2.20% 2.15% 89.25% NA
Indica III  913 4.50% 22.90% 2.19% 70.43% NA
Indica Intermediate  786 9.40% 13.70% 5.47% 71.37% NA
Temperate Japonica  767 99.50% 0.00% 0.13% 0.39% NA
Tropical Japonica  504 92.50% 0.00% 1.98% 0.20% ATT: 5.16%; A: 0.20%
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 63.30% 2.20% 6.67% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230107152 AT -> A LOC_Os02g49250.1 upstream_gene_variant ; 2522.0bp to feature; MODIFIER silent_mutation Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965 N N N N
vg0230107152 AT -> A LOC_Os02g49270.1 upstream_gene_variant ; 3088.0bp to feature; MODIFIER silent_mutation Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965 N N N N
vg0230107152 AT -> A LOC_Os02g49260.1 intron_variant ; MODIFIER silent_mutation Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965 N N N N
vg0230107152 AT -> TT LOC_Os02g49250.1 upstream_gene_variant ; 2521.0bp to feature; MODIFIER silent_mutation Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965 N N N N
vg0230107152 AT -> TT LOC_Os02g49270.1 upstream_gene_variant ; 3089.0bp to feature; MODIFIER silent_mutation Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965 N N N N
vg0230107152 AT -> TT LOC_Os02g49260.1 intron_variant ; MODIFIER silent_mutation Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965 N N N N
vg0230107152 AT -> ATT LOC_Os02g49250.1 upstream_gene_variant ; 2523.0bp to feature; MODIFIER silent_mutation Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965 N N N N
vg0230107152 AT -> ATT LOC_Os02g49270.1 upstream_gene_variant ; 3087.0bp to feature; MODIFIER silent_mutation Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965 N N N N
vg0230107152 AT -> ATT LOC_Os02g49260.1 intron_variant ; MODIFIER silent_mutation Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965 N N N N
vg0230107152 AT -> DEL N N silent_mutation Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0230107152 AT A 0.13 0.02 0.0 0.05 0.05 0.04
vg0230107152 AT ATT 0.27 0.06 0.03 0.09 0.07 -0.09
vg0230107152 AT TT 0.0 -0.01 -0.02 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230107152 NA 3.82E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152 7.81E-07 NA mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152 1.45E-06 6.08E-15 mr1798 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152 NA 3.49E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152 NA 5.72E-08 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152 NA 5.36E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152 NA 2.83E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152 4.34E-06 3.40E-17 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152 NA 6.42E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251