Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0230107152:

Variant ID: vg0230107152 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 30107152
Reference Allele: AT	Alternative Allele: TT,ATT,A
Primary Allele: AT	Secondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAATTTTGCTGTTGCTGTTGGTATCATCATGGCAAACAAAATGGTAGTAATATTTTTTTTTAAAAAAAAAGTGTACAGTTTTTTGTATACTCGTGCAA[AT/TT,ATT,A]
TTTTTTTTTTGGTCTACAAGGAAACATGATTGTTCACACACAGGATCTACTGTCTTTGTAGGTGATGGGGAGTGTTGGGTTTAAGTTCCCAATTGCACTA

Reverse complement sequence

TAGTGCAATTGGGAACTTAAACCCAACACTCCCCATCACCTACAAAGACAGTAGATCCTGTGTGTGAACAATCATGTTTCCTTGTAGACCAAAAAAAAAA[AT/AA,AAT,T]
TTGCACGAGTATACAAAAAACTGTACACTTTTTTTTTAAAAAAAAATATTACTACCATTTTGTTTGCCATGATGATACCAACAGCAACAGCAAAATTAAA

Allele Frequencies:

Populations	Population Size	Frequency of AT(primary allele)	Frequency of TT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.70%	8.80%	3.77%	46.17%	ATT: 0.55%; A: 0.02%
All Indica	2759	6.20%	13.50%	4.10%	76.26%	NA
All Japonica	1512	97.20%	0.00%	0.73%	0.33%	ATT: 1.72%; A: 0.07%
Aus	269	49.40%	15.20%	17.84%	17.47%	NA
Indica I	595	4.20%	7.60%	6.72%	81.51%	NA
Indica II	465	6.50%	2.20%	2.15%	89.25%	NA
Indica III	913	4.50%	22.90%	2.19%	70.43%	NA
Indica Intermediate	786	9.40%	13.70%	5.47%	71.37%	NA
Temperate Japonica	767	99.50%	0.00%	0.13%	0.39%	NA
Tropical Japonica	504	92.50%	0.00%	1.98%	0.20%	ATT: 5.16%; A: 0.20%
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	63.30%	2.20%	6.67%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230107152	AT -> A	LOC_Os02g49250.1	upstream_gene_variant ; 2522.0bp to feature; MODIFIER	silent_mutation	Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965	N	N	N	N
vg0230107152	AT -> A	LOC_Os02g49270.1	upstream_gene_variant ; 3088.0bp to feature; MODIFIER	silent_mutation	Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965	N	N	N	N
vg0230107152	AT -> A	LOC_Os02g49260.1	intron_variant ; MODIFIER	silent_mutation	Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965	N	N	N	N
vg0230107152	AT -> TT	LOC_Os02g49250.1	upstream_gene_variant ; 2521.0bp to feature; MODIFIER	silent_mutation	Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965	N	N	N	N
vg0230107152	AT -> TT	LOC_Os02g49270.1	upstream_gene_variant ; 3089.0bp to feature; MODIFIER	silent_mutation	Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965	N	N	N	N
vg0230107152	AT -> TT	LOC_Os02g49260.1	intron_variant ; MODIFIER	silent_mutation	Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965	N	N	N	N
vg0230107152	AT -> ATT	LOC_Os02g49250.1	upstream_gene_variant ; 2523.0bp to feature; MODIFIER	silent_mutation	Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965	N	N	N	N
vg0230107152	AT -> ATT	LOC_Os02g49270.1	upstream_gene_variant ; 3087.0bp to feature; MODIFIER	silent_mutation	Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965	N	N	N	N
vg0230107152	AT -> ATT	LOC_Os02g49260.1	intron_variant ; MODIFIER	silent_mutation	Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965	N	N	N	N
vg0230107152	AT -> DEL	N	N	silent_mutation	Average:72.269; most accessible tissue: Zhenshan97 flower, score: 91.965	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0230107152	AT	A	0.13	0.02	0.0	0.05	0.05	0.04
vg0230107152	AT	ATT	0.27	0.06	0.03	0.09	0.07	-0.09
vg0230107152	AT	TT	0.0	-0.01	-0.02	0.0	0.0	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230107152	NA	3.82E-07	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152	7.81E-07	NA	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152	1.45E-06	6.08E-15	mr1798	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152	NA	3.49E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152	NA	5.72E-08	mr1364_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152	NA	5.36E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152	NA	2.83E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152	4.34E-06	3.40E-17	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230107152	NA	6.42E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251