\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230082779:

Variant ID: vg0230082779 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30082779
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTGCAGCCAAGTTTTTTTTGTACAAACCTAGTACTACTGAATAAAGATTAATTATACAAATGTAGTTTTTGATTACTATTGACTGCTAGTACTAGACC[G/A]
GACTGCATCTACATGCTATATTCTAAATCTGATTTGATTCCAGTCACAGTCCAGTTACAGTCCATATGCACTGCAATTACATTTGTAATTTCTTTTGTTT

Reverse complement sequence

AAACAAAAGAAATTACAAATGTAATTGCAGTGCATATGGACTGTAACTGGACTGTGACTGGAATCAAATCAGATTTAGAATATAGCATGTAGATGCAGTC[C/T]
GGTCTAGTACTAGCAGTCAATAGTAATCAAAAACTACATTTGTATAATTAATCTTTATTCAGTAGTACTAGGTTTGTACAAAAAAAACTTGGCTGCACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 5.80% 1.18% 0.00% NA
All Indica  2759 88.30% 9.80% 1.88% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 56.60% 36.10% 7.31% 0.00% NA
Indica III  913 98.80% 1.10% 0.11% 0.00% NA
Indica Intermediate  786 86.40% 11.80% 1.78% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 2.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230082779 G -> A LOC_Os02g49200.1 downstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:25.094; most accessible tissue: Callus, score: 54.891 N N N N
vg0230082779 G -> A LOC_Os02g49220.1 downstream_gene_variant ; 4314.0bp to feature; MODIFIER silent_mutation Average:25.094; most accessible tissue: Callus, score: 54.891 N N N N
vg0230082779 G -> A LOC_Os02g49210.1 intron_variant ; MODIFIER silent_mutation Average:25.094; most accessible tissue: Callus, score: 54.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230082779 NA 4.31E-08 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 1.74E-10 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 2.41E-13 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 3.04E-10 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 2.54E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 6.62E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 8.46E-07 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 4.15E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 6.64E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 2.07E-11 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 3.71E-09 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 2.59E-07 NA mr1907_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 1.13E-06 3.86E-13 mr1907_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 3.29E-06 NA mr1934_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 9.00E-14 mr1934_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230082779 NA 2.99E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251