\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230005440:

Variant ID: vg0230005440 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 30005440
Reference Allele: GAlternative Allele: T,GTAC,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TGGACAATATTAGCAAAATCTGCAATATGAATTTTCATGAAATATATATTCGGTGTCAATGATAAGTTCATGGAAGGTTGATGGGAGAGAAAGTAGTATA[G/T,GTAC,A]
TACTTCCTCCGTTTCACAATGTAAGTCTTTCTAGCTTTGCCCACATTCATATAGATGTTAATGAATGGCTATAGAGTTTTCCCAGATGCCACAGCAGATT

Reverse complement sequence

AATCTGCTGTGGCATCTGGGAAAACTCTATAGCCATTCATTAACATCTATATGAATGTGGGCAAAGCTAGAAAGACTTACATTGTGAAACGGAGGAAGTA[C/A,GTAC,T]
TATACTACTTTCTCTCCCATCAACCTTCCATGAACTTATCATTGACACCGAATATATATTTCATGAAAATTCATATTGCAGATTTTGCTAATATTGTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 17.90% 6.81% 0.00% GTAC: 2.48%; A: 0.15%
All Indica  2759 54.40% 30.30% 11.38% 0.00% GTAC: 3.66%; A: 0.22%
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 94.40% 0.00% 0.00% 0.00% GTAC: 5.58%
Indica I  595 13.40% 52.30% 30.25% 0.00% GTAC: 4.03%
Indica II  465 65.60% 22.40% 11.83% 0.00% GTAC: 0.22%
Indica III  913 73.80% 22.70% 1.64% 0.00% GTAC: 1.64%; A: 0.22%
Indica Intermediate  786 56.20% 27.40% 8.14% 0.00% GTAC: 7.76%; A: 0.51%
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 7.80% 6.67% 0.00% GTAC: 1.11%; A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230005440 G -> A LOC_Os02g49070.1 upstream_gene_variant ; 2627.0bp to feature; MODIFIER silent_mutation Average:49.744; most accessible tissue: Callus, score: 88.12 N N N N
vg0230005440 G -> A LOC_Os02g49070-LOC_Os02g49080 intergenic_region ; MODIFIER silent_mutation Average:49.744; most accessible tissue: Callus, score: 88.12 N N N N
vg0230005440 G -> T LOC_Os02g49070.1 upstream_gene_variant ; 2627.0bp to feature; MODIFIER silent_mutation Average:49.744; most accessible tissue: Callus, score: 88.12 N N N N
vg0230005440 G -> T LOC_Os02g49070-LOC_Os02g49080 intergenic_region ; MODIFIER silent_mutation Average:49.744; most accessible tissue: Callus, score: 88.12 N N N N
vg0230005440 G -> GTAC LOC_Os02g49070.1 upstream_gene_variant ; 2628.0bp to feature; MODIFIER silent_mutation Average:49.744; most accessible tissue: Callus, score: 88.12 N N N N
vg0230005440 G -> GTAC LOC_Os02g49070-LOC_Os02g49080 intergenic_region ; MODIFIER silent_mutation Average:49.744; most accessible tissue: Callus, score: 88.12 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230005440 NA 2.61E-11 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0230005440 NA 1.21E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 2.68E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 2.35E-15 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 8.31E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 1.06E-06 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 9.92E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 2.80E-08 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 7.72E-09 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 1.08E-10 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 7.80E-09 mr1123_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 6.93E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 5.09E-07 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 3.53E-07 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 4.69E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 7.26E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 3.70E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 9.65E-11 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 5.52E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 8.73E-06 mr1239_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 1.31E-10 mr1242_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 5.78E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 3.34E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 7.72E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 1.54E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 2.03E-09 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 1.38E-23 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 8.61E-11 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 5.44E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 4.10E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 2.94E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 6.63E-07 mr1740_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 2.97E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 2.05E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 8.76E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 8.49E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 2.41E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 2.81E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 1.02E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 4.60E-08 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 2.28E-09 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 1.30E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440 NA 4.38E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251