Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230005440:

Variant ID: vg0230005440 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 30005440
Reference Allele: G	Alternative Allele: T,GTAC,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

TGGACAATATTAGCAAAATCTGCAATATGAATTTTCATGAAATATATATTCGGTGTCAATGATAAGTTCATGGAAGGTTGATGGGAGAGAAAGTAGTATA[G/T,GTAC,A]
TACTTCCTCCGTTTCACAATGTAAGTCTTTCTAGCTTTGCCCACATTCATATAGATGTTAATGAATGGCTATAGAGTTTTCCCAGATGCCACAGCAGATT

Reverse complement sequence

AATCTGCTGTGGCATCTGGGAAAACTCTATAGCCATTCATTAACATCTATATGAATGTGGGCAAAGCTAGAAAGACTTACATTGTGAAACGGAGGAAGTA[C/A,GTAC,T]
TATACTACTTTCTCTCCCATCAACCTTCCATGAACTTATCATTGACACCGAATATATATTTCATGAAAATTCATATTGCAGATTTTGCTAATATTGTCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.70%	17.90%	6.81%	0.00%	GTAC: 2.48%; A: 0.15%
All Indica	2759	54.40%	30.30%	11.38%	0.00%	GTAC: 3.66%; A: 0.22%
All Japonica	1512	99.80%	0.10%	0.13%	0.00%	NA
Aus	269	94.40%	0.00%	0.00%	0.00%	GTAC: 5.58%
Indica I	595	13.40%	52.30%	30.25%	0.00%	GTAC: 4.03%
Indica II	465	65.60%	22.40%	11.83%	0.00%	GTAC: 0.22%
Indica III	913	73.80%	22.70%	1.64%	0.00%	GTAC: 1.64%; A: 0.22%
Indica Intermediate	786	56.20%	27.40%	8.14%	0.00%	GTAC: 7.76%; A: 0.51%
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	7.80%	6.67%	0.00%	GTAC: 1.11%; A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230005440	G -> A	LOC_Os02g49070.1	upstream_gene_variant ; 2627.0bp to feature; MODIFIER	silent_mutation	Average:49.744; most accessible tissue: Callus, score: 88.12	N	N	N	N
vg0230005440	G -> A	LOC_Os02g49070-LOC_Os02g49080	intergenic_region ; MODIFIER	silent_mutation	Average:49.744; most accessible tissue: Callus, score: 88.12	N	N	N	N
vg0230005440	G -> T	LOC_Os02g49070.1	upstream_gene_variant ; 2627.0bp to feature; MODIFIER	silent_mutation	Average:49.744; most accessible tissue: Callus, score: 88.12	N	N	N	N
vg0230005440	G -> T	LOC_Os02g49070-LOC_Os02g49080	intergenic_region ; MODIFIER	silent_mutation	Average:49.744; most accessible tissue: Callus, score: 88.12	N	N	N	N
vg0230005440	G -> GTAC	LOC_Os02g49070.1	upstream_gene_variant ; 2628.0bp to feature; MODIFIER	silent_mutation	Average:49.744; most accessible tissue: Callus, score: 88.12	N	N	N	N
vg0230005440	G -> GTAC	LOC_Os02g49070-LOC_Os02g49080	intergenic_region ; MODIFIER	silent_mutation	Average:49.744; most accessible tissue: Callus, score: 88.12	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230005440	NA	2.61E-11	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0230005440	NA	1.21E-09	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	2.68E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	2.35E-15	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	8.31E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	1.06E-06	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	9.92E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	2.80E-08	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	7.72E-09	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	1.08E-10	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	7.80E-09	mr1123_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	6.93E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	5.09E-07	mr1148_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	3.53E-07	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	4.69E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	7.26E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	3.70E-09	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	9.65E-11	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	5.52E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	8.73E-06	mr1239_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	1.31E-10	mr1242_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	5.78E-06	mr1266_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	3.34E-08	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	7.72E-06	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	1.54E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	2.03E-09	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	1.38E-23	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	8.61E-11	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	5.44E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	4.10E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	2.94E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	6.63E-07	mr1740_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	2.97E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	2.05E-06	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	8.76E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	8.49E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	2.41E-06	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	2.81E-06	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	1.02E-12	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	4.60E-08	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	2.28E-09	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	1.30E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230005440	NA	4.38E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251