Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229752031:

Variant ID: vg0229752031 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29752031
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATCCCATCATGGTAAAAGTAAACCGCTTCCCTAGGGCTAGGGATCCTTCTGTCTTTGCTTTTTTAATCTGGAAAATGGCAAGAAGCCAAGAACACA[C/A]
ACTCTCTCTCAGTATTTTTCAACGGTTGGTAAGCTGTAAATAAAAGCATAAACAAACAGCAAATGACTCCTCAGTAGTAGTACTAGTACAGGAGTAGCAG

Reverse complement sequence

CTGCTACTCCTGTACTAGTACTACTACTGAGGAGTCATTTGCTGTTTGTTTATGCTTTTATTTACAGCTTACCAACCGTTGAAAAATACTGAGAGAGAGT[G/T]
TGTGTTCTTGGCTTCTTGCCATTTTCCAGATTAAAAAAGCAAAGACAGAAGGATCCCTAGCCCTAGGGAAGCGGTTTACTTTTACCATGATGGGATTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.60% 0.08% 0.00% NA
All Indica  2759 31.20% 68.60% 0.14% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 24.20% 75.80% 0.00% 0.00% NA
Indica II  465 6.00% 94.00% 0.00% 0.00% NA
Indica III  913 48.40% 51.40% 0.22% 0.00% NA
Indica Intermediate  786 31.60% 68.20% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229752031 C -> A LOC_Os02g48600.1 upstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:79.749; most accessible tissue: Callus, score: 99.33 N N N N
vg0229752031 C -> A LOC_Os02g48610.1 upstream_gene_variant ; 3980.0bp to feature; MODIFIER silent_mutation Average:79.749; most accessible tissue: Callus, score: 99.33 N N N N
vg0229752031 C -> A LOC_Os02g48610.2 upstream_gene_variant ; 3980.0bp to feature; MODIFIER silent_mutation Average:79.749; most accessible tissue: Callus, score: 99.33 N N N N
vg0229752031 C -> A LOC_Os02g48590.1 downstream_gene_variant ; 4617.0bp to feature; MODIFIER silent_mutation Average:79.749; most accessible tissue: Callus, score: 99.33 N N N N
vg0229752031 C -> A LOC_Os02g48590-LOC_Os02g48600 intergenic_region ; MODIFIER silent_mutation Average:79.749; most accessible tissue: Callus, score: 99.33 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0229752031 C A -0.24 -0.08 -0.06 -0.06 -0.07 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229752031 NA 1.90E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229752031 NA 4.35E-16 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229752031 NA 5.30E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 3.01E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 2.09E-52 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 3.99E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 2.59E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 4.57E-23 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 3.15E-10 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 1.93E-20 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 3.36E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 4.67E-19 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 5.21E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 5.97E-18 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 1.04E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 2.66E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 3.62E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 8.69E-31 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 7.46E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 1.82E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 8.21E-07 mr1754_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 1.85E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 9.88E-13 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 4.14E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 2.77E-09 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 1.48E-06 1.48E-06 mr1891_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229752031 NA 1.98E-07 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251