\
| Variant ID: vg0229643363 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 29643363 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACATTAAAATACACGGATGGAATAATATTTTGGCCAACTTACCTAAGGTTTGGCTAACAAAATTGAAGATACACTTTAGTTAGCATAAGCCACTATTGCC[A/G]
CATCTTTTTATCTCAATGGCATGCGAAGCCTATATAGTGAAGAAAGAATCTTGTCTTAAGTATGACTAATCCACCTAACTTAGTTAGATTTGTCTAACGC
GCGTTAGACAAATCTAACTAAGTTAGGTGGATTAGTCATACTTAAGACAAGATTCTTTCTTCACTATATAGGCTTCGCATGCCATTGAGATAAAAAGATG[T/C]
GGCAATAGTGGCTTATGCTAACTAAAGTGTATCTTCAATTTTGTTAGCCAAACCTTAGGTAAGTTGGCCAAAATATTATTCCATCCGTGTATTTTAATGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.40% | 1.10% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.00% | 3.40% | 1.52% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.40% | 6.00% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.50% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0229643363 | A -> G | LOC_Os02g48410.1 | upstream_gene_variant ; 1904.0bp to feature; MODIFIER | silent_mutation | Average:30.261; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0229643363 | A -> G | LOC_Os02g48400.1 | downstream_gene_variant ; 4012.0bp to feature; MODIFIER | silent_mutation | Average:30.261; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0229643363 | A -> G | LOC_Os02g48400-LOC_Os02g48410 | intergenic_region ; MODIFIER | silent_mutation | Average:30.261; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0229643363 | NA | 9.31E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229643363 | 3.49E-06 | 3.49E-06 | mr1412 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229643363 | NA | 8.18E-06 | mr1816 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |