\
| Variant ID: vg0229375522 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 29375522 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 277. )
TACAAAACAAATGAATATTCTGCAGTGCCTTGTGATTCAGCATGTATACATTCCTTATATTTAACAAGAATCAGGGTTATGTGATCTAGTGGAAGCTTTC[T/A]
AGCAAATGCAGTGTTTTTCACTTAAATGACTTAAACTGGCAGGCAGTTTTCTTCATCAGCTGATGTTGGATAATTGCGGGTGAAGGGTAATAGAACGTGC
GCACGTTCTATTACCCTTCACCCGCAATTATCCAACATCAGCTGATGAAGAAAACTGCCTGCCAGTTTAAGTCATTTAAGTGAAAAACACTGCATTTGCT[A/T]
GAAAGCTTCCACTAGATCACATAACCCTGATTCTTGTTAAATATAAGGAATGTATACATGCTGAATCACAAGGCACTGCAGAATATTCATTTGTTTTGTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.00% | 36.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 37.70% | 62.20% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 20.50% | 79.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 41.70% | 58.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 40.80% | 59.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0229375522 | T -> A | LOC_Os02g48000.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.619; most accessible tissue: Callus, score: 70.269 | N | N | N | N |
| vg0229375522 | T -> A | LOC_Os02g48000.2 | intron_variant ; MODIFIER | silent_mutation | Average:43.619; most accessible tissue: Callus, score: 70.269 | N | N | N | N |
| vg0229375522 | T -> A | LOC_Os02g48000.3 | intron_variant ; MODIFIER | silent_mutation | Average:43.619; most accessible tissue: Callus, score: 70.269 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0229375522 | NA | 1.40E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229375522 | NA | 9.48E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229375522 | NA | 9.25E-07 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229375522 | NA | 1.03E-08 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229375522 | NA | 1.66E-06 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229375522 | 3.24E-06 | NA | mr1156_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229375522 | 8.20E-06 | 4.66E-06 | mr1156_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229375522 | NA | 1.17E-08 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229375522 | 9.98E-07 | 1.48E-16 | mr1514_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229375522 | 8.53E-06 | 9.56E-06 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |