\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229036658:

Variant ID: vg0229036658 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29036658
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATGTGTTGTGCGTTACTACAATCCCATCGCGACGTTATTGTAAGTGTGCAGTAAAGACCATAAGTTTTGTAGCAACAATGCGTCTTACTGCAATTCTT[G/A]
AATAGTGTTACTGCATAAACATGTGGTAACGTGTACCTGCTATGTAGTAACACTCCCACTTTGTGCGGTAACAAGTATATTTAGCATGTGAGACTTTTAA

Reverse complement sequence

TTAAAAGTCTCACATGCTAAATATACTTGTTACCGCACAAAGTGGGAGTGTTACTACATAGCAGGTACACGTTACCACATGTTTATGCAGTAACACTATT[C/T]
AAGAATTGCAGTAAGACGCATTGTTGCTACAAAACTTATGGTCTTTACTGCACACTTACAATAACGTCGCGATGGGATTGTAGTAACGCACAACACATAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 0.40% 3.30% 38.38% NA
All Indica  2759 28.90% 0.70% 5.55% 64.95% NA
All Japonica  1512 99.70% 0.00% 0.00% 0.33% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 10.10% 1.20% 5.55% 83.19% NA
Indica II  465 28.60% 1.50% 7.53% 62.37% NA
Indica III  913 34.90% 0.00% 5.26% 59.80% NA
Indica Intermediate  786 36.10% 0.50% 4.71% 58.65% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 81.10% 0.00% 2.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229036658 G -> A LOC_Os02g47520.1 downstream_gene_variant ; 2593.0bp to feature; MODIFIER silent_mutation Average:8.414; most accessible tissue: Callus, score: 24.377 N N N N
vg0229036658 G -> A LOC_Os02g47530.1 downstream_gene_variant ; 2276.0bp to feature; MODIFIER silent_mutation Average:8.414; most accessible tissue: Callus, score: 24.377 N N N N
vg0229036658 G -> A LOC_Os02g47520-LOC_Os02g47530 intergenic_region ; MODIFIER silent_mutation Average:8.414; most accessible tissue: Callus, score: 24.377 N N N N
vg0229036658 G -> DEL N N silent_mutation Average:8.414; most accessible tissue: Callus, score: 24.377 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229036658 NA 9.40E-27 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229036658 NA 7.03E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229036658 NA 5.43E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229036658 NA 4.91E-29 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229036658 9.34E-06 8.96E-18 mr1514_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229036658 NA 9.60E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251