Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0229036658:

Variant ID: vg0229036658 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 29036658
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTATGTGTTGTGCGTTACTACAATCCCATCGCGACGTTATTGTAAGTGTGCAGTAAAGACCATAAGTTTTGTAGCAACAATGCGTCTTACTGCAATTCTT[G/A]
AATAGTGTTACTGCATAAACATGTGGTAACGTGTACCTGCTATGTAGTAACACTCCCACTTTGTGCGGTAACAAGTATATTTAGCATGTGAGACTTTTAA

Reverse complement sequence

TTAAAAGTCTCACATGCTAAATATACTTGTTACCGCACAAAGTGGGAGTGTTACTACATAGCAGGTACACGTTACCACATGTTTATGCAGTAACACTATT[C/T]
AAGAATTGCAGTAAGACGCATTGTTGCTACAAAACTTATGGTCTTTACTGCACACTTACAATAACGTCGCGATGGGATTGTAGTAACGCACAACACATAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.90%	0.40%	3.30%	38.38%	NA
All Indica	2759	28.90%	0.70%	5.55%	64.95%	NA
All Japonica	1512	99.70%	0.00%	0.00%	0.33%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	10.10%	1.20%	5.55%	83.19%	NA
Indica II	465	28.60%	1.50%	7.53%	62.37%	NA
Indica III	913	34.90%	0.00%	5.26%	59.80%	NA
Indica Intermediate	786	36.10%	0.50%	4.71%	58.65%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	81.10%	0.00%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0229036658	G -> A	LOC_Os02g47520.1	downstream_gene_variant ; 2593.0bp to feature; MODIFIER	silent_mutation	Average:8.414; most accessible tissue: Callus, score: 24.377	N	N	N	N
vg0229036658	G -> A	LOC_Os02g47530.1	downstream_gene_variant ; 2276.0bp to feature; MODIFIER	silent_mutation	Average:8.414; most accessible tissue: Callus, score: 24.377	N	N	N	N
vg0229036658	G -> A	LOC_Os02g47520-LOC_Os02g47530	intergenic_region ; MODIFIER	silent_mutation	Average:8.414; most accessible tissue: Callus, score: 24.377	N	N	N	N
vg0229036658	G -> DEL	N	N	silent_mutation	Average:8.414; most accessible tissue: Callus, score: 24.377	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0229036658	NA	9.40E-27	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229036658	NA	7.03E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229036658	NA	5.43E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229036658	NA	4.91E-29	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229036658	9.34E-06	8.96E-18	mr1514_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229036658	NA	9.60E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251