\
| Variant ID: vg0229036658 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 29036658 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTATGTGTTGTGCGTTACTACAATCCCATCGCGACGTTATTGTAAGTGTGCAGTAAAGACCATAAGTTTTGTAGCAACAATGCGTCTTACTGCAATTCTT[G/A]
AATAGTGTTACTGCATAAACATGTGGTAACGTGTACCTGCTATGTAGTAACACTCCCACTTTGTGCGGTAACAAGTATATTTAGCATGTGAGACTTTTAA
TTAAAAGTCTCACATGCTAAATATACTTGTTACCGCACAAAGTGGGAGTGTTACTACATAGCAGGTACACGTTACCACATGTTTATGCAGTAACACTATT[C/T]
AAGAATTGCAGTAAGACGCATTGTTGCTACAAAACTTATGGTCTTTACTGCACACTTACAATAACGTCGCGATGGGATTGTAGTAACGCACAACACATAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.90% | 0.40% | 3.30% | 38.38% | NA |
| All Indica | 2759 | 28.90% | 0.70% | 5.55% | 64.95% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.00% | 0.33% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 10.10% | 1.20% | 5.55% | 83.19% | NA |
| Indica II | 465 | 28.60% | 1.50% | 7.53% | 62.37% | NA |
| Indica III | 913 | 34.90% | 0.00% | 5.26% | 59.80% | NA |
| Indica Intermediate | 786 | 36.10% | 0.50% | 4.71% | 58.65% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 0.00% | 2.22% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0229036658 | G -> A | LOC_Os02g47520.1 | downstream_gene_variant ; 2593.0bp to feature; MODIFIER | silent_mutation | Average:8.414; most accessible tissue: Callus, score: 24.377 | N | N | N | N |
| vg0229036658 | G -> A | LOC_Os02g47530.1 | downstream_gene_variant ; 2276.0bp to feature; MODIFIER | silent_mutation | Average:8.414; most accessible tissue: Callus, score: 24.377 | N | N | N | N |
| vg0229036658 | G -> A | LOC_Os02g47520-LOC_Os02g47530 | intergenic_region ; MODIFIER | silent_mutation | Average:8.414; most accessible tissue: Callus, score: 24.377 | N | N | N | N |
| vg0229036658 | G -> DEL | N | N | silent_mutation | Average:8.414; most accessible tissue: Callus, score: 24.377 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0229036658 | NA | 9.40E-27 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229036658 | NA | 7.03E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229036658 | NA | 5.43E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229036658 | NA | 4.91E-29 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229036658 | 9.34E-06 | 8.96E-18 | mr1514_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229036658 | NA | 9.60E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |