Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0228735427:

Variant ID: vg0228735427 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 28735427
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.12, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCAACCAATCACAATCATTCAACATTTATTTTCCACCTACCTCTACTTCTTAACCAATTACAACCTTCTCCATTTAATTTTATTTACTTTATTAATAA[T/C]
CGTGTTTAACTCTAAAACTTATTATATTCTGAAACGAAGGTAGTACAACTTATTTTTTTATCGATTTTAAATTTTGGACTTAATTATCAAAACATGAGAA

Reverse complement sequence

TTCTCATGTTTTGATAATTAAGTCCAAAATTTAAAATCGATAAAAAAATAAGTTGTACTACCTTCGTTTCAGAATATAATAAGTTTTAGAGTTAAACACG[A/G]
TTATTAATAAAGTAAATAAAATTAAATGGAGAAGGTTGTAATTGGTTAAGAAGTAGAGGTAGGTGGAAAATAAATGTTGAATGATTGTGATTGGTTGGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	41.30%	0.32%	0.04%	NA
All Indica	2759	86.50%	12.90%	0.47%	0.07%	NA
All Japonica	1512	11.00%	88.90%	0.07%	0.00%	NA
Aus	269	48.70%	51.30%	0.00%	0.00%	NA
Indica I	595	91.30%	8.20%	0.50%	0.00%	NA
Indica II	465	93.10%	6.00%	0.86%	0.00%	NA
Indica III	913	86.90%	13.00%	0.11%	0.00%	NA
Indica Intermediate	786	78.60%	20.50%	0.64%	0.25%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	31.70%	68.30%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	36.50%	63.50%	0.00%	0.00%	NA
Intermediate	90	43.30%	55.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0228735427	T -> DEL	N	N	silent_mutation	Average:34.978; most accessible tissue: Callus, score: 67.538	N	N	N	N
vg0228735427	T -> C	LOC_Os02g47060.1	downstream_gene_variant ; 4494.0bp to feature; MODIFIER	silent_mutation	Average:34.978; most accessible tissue: Callus, score: 67.538	N	N	N	N
vg0228735427	T -> C	LOC_Os02g47070.1	downstream_gene_variant ; 2775.0bp to feature; MODIFIER	silent_mutation	Average:34.978; most accessible tissue: Callus, score: 67.538	N	N	N	N
vg0228735427	T -> C	LOC_Os02g47060-LOC_Os02g47070	intergenic_region ; MODIFIER	silent_mutation	Average:34.978; most accessible tissue: Callus, score: 67.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0228735427	NA	7.49E-20	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228735427	NA	1.18E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228735427	3.32E-06	NA	mr1072_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228735427	9.70E-07	NA	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228735427	6.48E-06	NA	mr1160_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228735427	NA	1.01E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228735427	NA	1.06E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228735427	NA	3.14E-07	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251