Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228320179:

Variant ID: vg0228320179 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 28320179
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTATTTCCTCCGTTTCACAATGTAAGTCATTCTAGTATTTTCCACATTCATTATGGATGTTAATGAATCTAGACATATATATCTATCTAGATTCATTAG[C/T]
ATCAATATGAATGTGAAAAATCTATCTTGATGCTAATGAATCTAGATAGATATATATGTCTAGATTTATTAACATCTATATGAATGTGGAAAATACTAGA

Reverse complement sequence

TCTAGTATTTTCCACATTCATATAGATGTTAATAAATCTAGACATATATATCTATCTAGATTCATTAGCATCAAGATAGATTTTTCACATTCATATTGAT[G/A]
CTAATGAATCTAGATAGATATATATGTCTAGATTCATTAACATCCATAATGAATGTGGAAAATACTAGAATGACTTACATTGTGAAACGGAGGAAATAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	4.10%	1.38%	4.19%	NA
All Indica	2759	93.60%	0.10%	1.34%	5.00%	NA
All Japonica	1512	85.90%	12.30%	1.52%	0.26%	NA
Aus	269	79.20%	0.40%	1.86%	18.59%	NA
Indica I	595	97.50%	0.00%	2.52%	0.00%	NA
Indica II	465	92.90%	0.00%	1.29%	5.81%	NA
Indica III	913	93.20%	0.20%	0.66%	5.91%	NA
Indica Intermediate	786	91.50%	0.00%	1.27%	7.25%	NA
Temperate Japonica	767	98.00%	0.70%	1.30%	0.00%	NA
Tropical Japonica	504	78.20%	19.60%	1.39%	0.79%	NA
Japonica Intermediate	241	63.50%	34.00%	2.49%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	5.60%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0228320179	C -> T	LOC_Os02g46460.1	upstream_gene_variant ; 3981.0bp to feature; MODIFIER	silent_mutation	Average:37.859; most accessible tissue: Callus, score: 77.236	N	N	N	N
vg0228320179	C -> T	LOC_Os02g46473.1	upstream_gene_variant ; 871.0bp to feature; MODIFIER	silent_mutation	Average:37.859; most accessible tissue: Callus, score: 77.236	N	N	N	N
vg0228320179	C -> T	LOC_Os02g46460.2	upstream_gene_variant ; 3981.0bp to feature; MODIFIER	silent_mutation	Average:37.859; most accessible tissue: Callus, score: 77.236	N	N	N	N
vg0228320179	C -> T	LOC_Os02g46473-LOC_Os02g46480	intergenic_region ; MODIFIER	silent_mutation	Average:37.859; most accessible tissue: Callus, score: 77.236	N	N	N	N
vg0228320179	C -> DEL	N	N	silent_mutation	Average:37.859; most accessible tissue: Callus, score: 77.236	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0228320179	2.18E-08	NA	mr1124_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	NA	3.73E-06	mr1289_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	1.06E-06	1.06E-06	mr1312_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	3.72E-06	3.72E-06	mr1453_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	4.92E-06	4.91E-06	mr1470_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	NA	6.69E-08	mr1544_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	3.66E-06	3.66E-06	mr1634_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	NA	7.54E-07	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	NA	3.82E-06	mr1665_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	NA	2.08E-06	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	NA	8.68E-06	mr1821_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	7.18E-06	7.18E-06	mr1832_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	NA	2.85E-06	mr1923_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179	NA	2.00E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251