\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228320179:

Variant ID: vg0228320179 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28320179
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTATTTCCTCCGTTTCACAATGTAAGTCATTCTAGTATTTTCCACATTCATTATGGATGTTAATGAATCTAGACATATATATCTATCTAGATTCATTAG[C/T]
ATCAATATGAATGTGAAAAATCTATCTTGATGCTAATGAATCTAGATAGATATATATGTCTAGATTTATTAACATCTATATGAATGTGGAAAATACTAGA

Reverse complement sequence

TCTAGTATTTTCCACATTCATATAGATGTTAATAAATCTAGACATATATATCTATCTAGATTCATTAGCATCAAGATAGATTTTTCACATTCATATTGAT[G/A]
CTAATGAATCTAGATAGATATATATGTCTAGATTCATTAACATCCATAATGAATGTGGAAAATACTAGAATGACTTACATTGTGAAACGGAGGAAATAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 4.10% 1.38% 4.19% NA
All Indica  2759 93.60% 0.10% 1.34% 5.00% NA
All Japonica  1512 85.90% 12.30% 1.52% 0.26% NA
Aus  269 79.20% 0.40% 1.86% 18.59% NA
Indica I  595 97.50% 0.00% 2.52% 0.00% NA
Indica II  465 92.90% 0.00% 1.29% 5.81% NA
Indica III  913 93.20% 0.20% 0.66% 5.91% NA
Indica Intermediate  786 91.50% 0.00% 1.27% 7.25% NA
Temperate Japonica  767 98.00% 0.70% 1.30% 0.00% NA
Tropical Japonica  504 78.20% 19.60% 1.39% 0.79% NA
Japonica Intermediate  241 63.50% 34.00% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 5.60% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228320179 C -> T LOC_Os02g46460.1 upstream_gene_variant ; 3981.0bp to feature; MODIFIER silent_mutation Average:37.859; most accessible tissue: Callus, score: 77.236 N N N N
vg0228320179 C -> T LOC_Os02g46473.1 upstream_gene_variant ; 871.0bp to feature; MODIFIER silent_mutation Average:37.859; most accessible tissue: Callus, score: 77.236 N N N N
vg0228320179 C -> T LOC_Os02g46460.2 upstream_gene_variant ; 3981.0bp to feature; MODIFIER silent_mutation Average:37.859; most accessible tissue: Callus, score: 77.236 N N N N
vg0228320179 C -> T LOC_Os02g46473-LOC_Os02g46480 intergenic_region ; MODIFIER silent_mutation Average:37.859; most accessible tissue: Callus, score: 77.236 N N N N
vg0228320179 C -> DEL N N silent_mutation Average:37.859; most accessible tissue: Callus, score: 77.236 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228320179 2.18E-08 NA mr1124_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 NA 3.73E-06 mr1289_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 1.06E-06 1.06E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 3.72E-06 3.72E-06 mr1453_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 4.92E-06 4.91E-06 mr1470_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 NA 6.69E-08 mr1544_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 3.66E-06 3.66E-06 mr1634_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 NA 7.54E-07 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 NA 3.82E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 NA 2.08E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 NA 8.68E-06 mr1821_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 7.18E-06 7.18E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 NA 2.85E-06 mr1923_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228320179 NA 2.00E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251