\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0228232599:

Variant ID: vg0228232599 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 28232599
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTTGACAGATGTAATTATAGTACAATCGTAATGTAATTACACTGTAACTTATATGTAATTACACTGTAACTTGCATGTAACTACAGTGTAACTTGTA[A/T]
ATAAGTTTCATTTAATTTTGAATCTTTAAATCTATTACAAGATTTGTTTTGGTAAGGAAGAAAAATAAAATCACAGCACACATATATGTGTAAGGATTTG

Reverse complement sequence

CAAATCCTTACACATATATGTGTGCTGTGATTTTATTTTTCTTCCTTACCAAAACAAATCTTGTAATAGATTTAAAGATTCAAAATTAAATGAAACTTAT[T/A]
TACAAGTTACACTGTAGTTACATGCAAGTTACAGTGTAATTACATATAAGTTACAGTGTAATTACATTACGATTGTACTATAATTACATCTGTCAAATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 35.80% 4.72% 2.03% NA
All Indica  2759 86.50% 2.40% 7.76% 3.37% NA
All Japonica  1512 9.60% 90.30% 0.13% 0.00% NA
Aus  269 57.60% 42.00% 0.37% 0.00% NA
Indica I  595 82.50% 0.50% 13.61% 3.36% NA
Indica II  465 85.20% 3.20% 9.25% 2.37% NA
Indica III  913 91.50% 1.20% 3.29% 4.05% NA
Indica Intermediate  786 84.50% 4.70% 7.63% 3.18% NA
Temperate Japonica  767 0.90% 99.00% 0.13% 0.00% NA
Tropical Japonica  504 26.40% 73.40% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 33.30% 56.70% 6.67% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0228232599 A -> T LOC_Os02g46320.1 upstream_gene_variant ; 1062.0bp to feature; MODIFIER silent_mutation Average:45.04; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0228232599 A -> T LOC_Os02g46310.1 downstream_gene_variant ; 209.0bp to feature; MODIFIER silent_mutation Average:45.04; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0228232599 A -> T LOC_Os02g46310-LOC_Os02g46320 intergenic_region ; MODIFIER silent_mutation Average:45.04; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0228232599 A -> DEL N N silent_mutation Average:45.04; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0228232599 NA 4.96E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 NA 5.75E-76 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 5.19E-06 5.19E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 3.37E-06 3.03E-06 mr1068_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 6.34E-06 2.85E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 1.24E-06 8.75E-08 mr1075_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 NA 4.09E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 6.67E-06 1.98E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 NA 4.22E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 5.52E-06 NA mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 1.36E-06 2.10E-08 mr1200_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 NA 6.53E-18 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 4.11E-09 NA mr1629_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0228232599 1.68E-06 1.07E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251