\
| Variant ID: vg0227788767 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 27788767 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 126. )
CTTAGTGGTCGTGAAAAGGATTCTAAGATATTTAAAGCATTCATCTACTATTGGCTTGTGGTACCCAAAAGGTGCTAAGTTTAAGCTTGTTGGCTATTCC[G/A]
ATTCGGATTATGCCGGTTGCAAAGTGGATAGAAAGAGCACAAAATGCTTGGTAGCTCCCTTGTGTCATGGTCATCCAAGAAACAAAACTCCGTAGCCCTC
GAGGGCTACGGAGTTTTGTTTCTTGGATGACCATGACACAAGGGAGCTACCAAGCATTTTGTGCTCTTTCTATCCACTTTGCAACCGGCATAATCCGAAT[C/T]
GGAATAGCCAACAAGCTTAAACTTAGCACCTTTTGGGTACCACAAGCCAATAGTAGATGAATGCTTTAAATATCTTAGAATCCTTTTCACGACCACTAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 5.00% | 2.35% | 0.00% | NA |
| All Indica | 2759 | 87.80% | 8.20% | 3.95% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 0.50% | 5.71% | 0.00% | NA |
| Indica II | 465 | 77.20% | 16.60% | 6.24% | 0.00% | NA |
| Indica III | 913 | 94.00% | 5.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 82.40% | 12.20% | 5.34% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0227788767 | G -> A | LOC_Os02g45680.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.308; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0227788767 | NA | 6.65E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 6.80E-06 | mr1020 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 2.36E-07 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 2.08E-07 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 1.61E-07 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 4.36E-08 | mr1478 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 1.74E-06 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 8.66E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 4.55E-06 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 7.67E-06 | mr1165_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 6.31E-08 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 8.84E-08 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0227788767 | NA | 1.91E-06 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |